Incidental Mutation 'R6593:Abcb1b'
ID523468
Institutional Source Beutler Lab
Gene Symbol Abcb1b
Ensembl Gene ENSMUSG00000028970
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 1B
SynonymsPgy-1, Abcb1, Mdr1, mdr, Pgy1, Mdr1b
MMRRC Submission
Accession Numbers

Genbank: NM_011075; MGI: 97568  

Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R6593 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location8798147-8866315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 8853491 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1047 (N1047K)
Ref Sequence ENSEMBL: ENSMUSP00000009058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009058] [ENSMUST00000199955]
Predicted Effect probably benign
Transcript: ENSMUST00000009058
AA Change: N1047K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000009058
Gene: ENSMUSG00000028970
AA Change: N1047K

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
Pfam:ABC_membrane 50 342 1.4e-96 PFAM
AAA 418 610 4.32e-21 SMART
Pfam:ABC_membrane 709 984 1.9e-75 PFAM
AAA 1060 1248 4.13e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196048
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197961
Predicted Effect unknown
Transcript: ENSMUST00000198650
AA Change: N28K
Predicted Effect probably benign
Transcript: ENSMUST00000199955
SMART Domains Protein: ENSMUSP00000143766
Gene: ENSMUSG00000028970

DomainStartEndE-ValueType
PDB:4M2T|B 1 78 2e-26 PDB
Blast:AAA 33 78 2e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199994
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 96.6%
  • 20x: 89.6%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. This gene encodes a membrane glycoprotein which confers a multidrug-resistance phenotype. The protein encoded by the human gene is an ATP-dependent drug efflux pump for xenobiotic compounds which is responsible for decreased drug accumulation in multidrug-resistant cells and mediates the development of resistance to anticancer drugs. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are hypersensitive to effects of drugs transported by phosphoglycoproteins. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(2) Gene trapped(8)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI597479 C A 1: 43,111,248 Q173K probably damaging Het
Arhgef10 T C 8: 14,962,522 L282P probably damaging Het
Arhgef10 T C 8: 14,962,564 I296T possibly damaging Het
Atg2b A G 12: 105,644,848 S1275P probably damaging Het
Ccdc114 T A 7: 45,947,384 D378E probably damaging Het
Cep290 T C 10: 100,508,776 M485T probably benign Het
Clca3a2 A G 3: 144,808,577 probably null Het
Clcn6 C T 4: 148,010,769 S731N probably benign Het
Clic6 A G 16: 92,528,117 I388V possibly damaging Het
Cpsf4l G T 11: 113,709,366 probably benign Het
Ddx58 T C 4: 40,226,651 I169V probably benign Het
Dlg5 G A 14: 24,150,652 H1350Y probably benign Het
Dnase2b T C 3: 146,586,911 Y169C probably damaging Het
Elavl3 C T 9: 22,018,547 V354M possibly damaging Het
Farp2 A C 1: 93,569,940 I231L possibly damaging Het
Gcc2 T A 10: 58,271,507 M755K probably damaging Het
Gpr88 T C 3: 116,252,624 T13A unknown Het
Gstm3 T A 3: 107,968,195 N40Y probably benign Het
Krtap5-2 A T 7: 142,174,960 C328S unknown Het
Lpar1 A T 4: 58,486,605 V222E probably damaging Het
Neto2 A G 8: 85,669,546 S192P probably damaging Het
Olfr665 C T 7: 104,881,433 T242I probably damaging Het
Pcdhgb1 G T 18: 37,682,081 D542Y probably damaging Het
Phldb2 G A 16: 45,825,427 Q264* probably null Het
Ptgs2 G A 1: 150,101,033 D6N possibly damaging Het
Rasef G T 4: 73,745,090 H167N probably damaging Het
Rbbp4 A G 4: 129,322,375 L193S probably damaging Het
Sec24d T C 3: 123,353,412 F673S probably damaging Het
Slc9b1 T C 3: 135,357,458 M1T probably null Het
Stra6 A G 9: 58,151,979 T542A probably benign Het
Stt3b T C 9: 115,252,511 Y569C probably damaging Het
Traf3ip1 A G 1: 91,527,695 K626R possibly damaging Het
Washc2 T A 6: 116,259,249 I1227N probably damaging Het
Xpo7 G A 14: 70,682,362 A671V probably damaging Het
Zfp799 A G 17: 32,819,790 Y501H probably damaging Het
Other mutations in Abcb1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Abcb1b APN 5 8827704 missense probably benign 0.34
IGL00979:Abcb1b APN 5 8825293 splice site probably benign
IGL02157:Abcb1b APN 5 8805487 splice site probably benign
IGL02478:Abcb1b APN 5 8806018 missense probably damaging 0.98
IGL03174:Abcb1b APN 5 8827752 missense probably benign 0.03
IGL03189:Abcb1b APN 5 8845814 missense probably benign
IGL03195:Abcb1b APN 5 8853607 missense possibly damaging 0.83
PIT4283001:Abcb1b UTSW 5 8813693 missense probably damaging 1.00
R0049:Abcb1b UTSW 5 8825661 missense probably damaging 1.00
R0166:Abcb1b UTSW 5 8853468 missense probably damaging 1.00
R0254:Abcb1b UTSW 5 8827409 missense probably benign
R0319:Abcb1b UTSW 5 8827428 missense probably benign 0.01
R0358:Abcb1b UTSW 5 8821423 missense probably benign 0.16
R0365:Abcb1b UTSW 5 8806009 missense probably damaging 1.00
R0408:Abcb1b UTSW 5 8853446 missense probably damaging 0.98
R0521:Abcb1b UTSW 5 8864238 missense probably damaging 1.00
R0533:Abcb1b UTSW 5 8864113 critical splice acceptor site probably null
R0847:Abcb1b UTSW 5 8845764 missense probably damaging 0.99
R1037:Abcb1b UTSW 5 8825657 missense probably benign 0.03
R1432:Abcb1b UTSW 5 8837771 missense possibly damaging 0.69
R1437:Abcb1b UTSW 5 8821436 missense possibly damaging 0.90
R1520:Abcb1b UTSW 5 8814768 missense probably damaging 1.00
R1686:Abcb1b UTSW 5 8798782 missense probably damaging 0.97
R1700:Abcb1b UTSW 5 8849537 missense probably benign 0.44
R1973:Abcb1b UTSW 5 8812746 missense probably benign 0.01
R1993:Abcb1b UTSW 5 8821322 missense possibly damaging 0.61
R2157:Abcb1b UTSW 5 8824791 missense probably benign 0.37
R2207:Abcb1b UTSW 5 8824803 missense probably benign 0.23
R2968:Abcb1b UTSW 5 8861485 missense probably damaging 1.00
R3858:Abcb1b UTSW 5 8813581 missense probably benign 0.11
R4223:Abcb1b UTSW 5 8813722 missense probably damaging 0.97
R4379:Abcb1b UTSW 5 8865875 missense probably benign 0.00
R4674:Abcb1b UTSW 5 8810615 missense probably benign
R4964:Abcb1b UTSW 5 8812671 missense probably benign 0.00
R4964:Abcb1b UTSW 5 8861602 missense probably damaging 1.00
R5167:Abcb1b UTSW 5 8812656 missense probably damaging 0.98
R5216:Abcb1b UTSW 5 8813705 missense probably benign 0.04
R5328:Abcb1b UTSW 5 8837694 missense possibly damaging 0.69
R5391:Abcb1b UTSW 5 8805481 missense probably null 0.00
R5399:Abcb1b UTSW 5 8827410 missense probably benign
R6047:Abcb1b UTSW 5 8806066 missense probably damaging 1.00
R6157:Abcb1b UTSW 5 8824245 missense possibly damaging 0.81
R6293:Abcb1b UTSW 5 8853493 missense probably benign 0.05
R6493:Abcb1b UTSW 5 8824698 missense probably damaging 1.00
R6799:Abcb1b UTSW 5 8812656 missense probably damaging 0.98
R6944:Abcb1b UTSW 5 8813693 missense probably damaging 1.00
R7028:Abcb1b UTSW 5 8805441 missense probably damaging 0.99
R7227:Abcb1b UTSW 5 8825593 missense probably damaging 1.00
X0025:Abcb1b UTSW 5 8824515 missense possibly damaging 0.91
X0061:Abcb1b UTSW 5 8864269 splice site probably null
Predicted Primers PCR Primer
(F):5'- GGTGTGTCCTTTTGATCTGACTCAC -3'
(R):5'- AGACAGGGCAGCTTAGACAC -3'

Sequencing Primer
(F):5'- GATCTGACTCACCTGACAGCTG -3'
(R):5'- GGGCAGCTTAGACACCAAACATG -3'
Posted On2018-06-22