Incidental Mutation 'R6593:Ccdc114'
ID523470
Institutional Source Beutler Lab
Gene Symbol Ccdc114
Ensembl Gene ENSMUSG00000040189
Gene Namecoiled-coil domain containing 114
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6593 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45924072-45948963 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45947384 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 378 (D378E)
Ref Sequence ENSEMBL: ENSMUSP00000042772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038720] [ENSMUST00000210867]
Predicted Effect probably damaging
Transcript: ENSMUST00000038720
AA Change: D378E

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000042772
Gene: ENSMUSG00000040189
AA Change: D378E

DomainStartEndE-ValueType
coiled coil region 11 94 N/A INTRINSIC
coiled coil region 137 156 N/A INTRINSIC
low complexity region 174 185 N/A INTRINSIC
coiled coil region 195 229 N/A INTRINSIC
coiled coil region 303 380 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 504 519 N/A INTRINSIC
low complexity region 558 588 N/A INTRINSIC
low complexity region 592 604 N/A INTRINSIC
low complexity region 621 656 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210867
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 96.6%
  • 20x: 89.6%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein that is a component of the outer dynein arm docking complex in cilia cells. Mutations in this gene may cause primary ciliary dyskinesia 20. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C A 5: 8,853,491 N1047K probably benign Het
AI597479 C A 1: 43,111,248 Q173K probably damaging Het
Arhgef10 T C 8: 14,962,522 L282P probably damaging Het
Arhgef10 T C 8: 14,962,564 I296T possibly damaging Het
Atg2b A G 12: 105,644,848 S1275P probably damaging Het
Cep290 T C 10: 100,508,776 M485T probably benign Het
Clca3a2 A G 3: 144,808,577 probably null Het
Clcn6 C T 4: 148,010,769 S731N probably benign Het
Clic6 A G 16: 92,528,117 I388V possibly damaging Het
Cpsf4l G T 11: 113,709,366 probably benign Het
Ddx58 T C 4: 40,226,651 I169V probably benign Het
Dlg5 G A 14: 24,150,652 H1350Y probably benign Het
Dnase2b T C 3: 146,586,911 Y169C probably damaging Het
Elavl3 C T 9: 22,018,547 V354M possibly damaging Het
Farp2 A C 1: 93,569,940 I231L possibly damaging Het
Gcc2 T A 10: 58,271,507 M755K probably damaging Het
Gpr88 T C 3: 116,252,624 T13A unknown Het
Gstm3 T A 3: 107,968,195 N40Y probably benign Het
Krtap5-2 A T 7: 142,174,960 C328S unknown Het
Lpar1 A T 4: 58,486,605 V222E probably damaging Het
Neto2 A G 8: 85,669,546 S192P probably damaging Het
Olfr665 C T 7: 104,881,433 T242I probably damaging Het
Pcdhgb1 G T 18: 37,682,081 D542Y probably damaging Het
Phldb2 G A 16: 45,825,427 Q264* probably null Het
Ptgs2 G A 1: 150,101,033 D6N possibly damaging Het
Rasef G T 4: 73,745,090 H167N probably damaging Het
Rbbp4 A G 4: 129,322,375 L193S probably damaging Het
Sec24d T C 3: 123,353,412 F673S probably damaging Het
Slc9b1 T C 3: 135,357,458 M1T probably null Het
Stra6 A G 9: 58,151,979 T542A probably benign Het
Stt3b T C 9: 115,252,511 Y569C probably damaging Het
Traf3ip1 A G 1: 91,527,695 K626R possibly damaging Het
Washc2 T A 6: 116,259,249 I1227N probably damaging Het
Xpo7 G A 14: 70,682,362 A671V probably damaging Het
Zfp799 A G 17: 32,819,790 Y501H probably damaging Het
Other mutations in Ccdc114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Ccdc114 APN 7 45942656 missense probably damaging 1.00
IGL01383:Ccdc114 APN 7 45939700 missense probably damaging 1.00
IGL01826:Ccdc114 APN 7 45948386 missense possibly damaging 0.62
R0865:Ccdc114 UTSW 7 45942088 missense probably benign 0.17
R1061:Ccdc114 UTSW 7 45941755 missense probably damaging 0.96
R1217:Ccdc114 UTSW 7 45942758 splice site probably benign
R1533:Ccdc114 UTSW 7 45942858 missense probably benign 0.00
R2863:Ccdc114 UTSW 7 45948312 missense probably benign 0.04
R3954:Ccdc114 UTSW 7 45941676 missense probably damaging 1.00
R4774:Ccdc114 UTSW 7 45948380 missense probably damaging 0.99
R4861:Ccdc114 UTSW 7 45942873 missense probably damaging 0.98
R4861:Ccdc114 UTSW 7 45942873 missense probably damaging 0.98
R4952:Ccdc114 UTSW 7 45942191 missense probably damaging 1.00
R5074:Ccdc114 UTSW 7 45929090 missense probably benign 0.05
R5187:Ccdc114 UTSW 7 45929116 missense probably damaging 1.00
R5265:Ccdc114 UTSW 7 45947435 missense probably damaging 1.00
R5364:Ccdc114 UTSW 7 45936332 missense probably damaging 0.99
R5377:Ccdc114 UTSW 7 45942082 nonsense probably null
R6221:Ccdc114 UTSW 7 45947479 missense probably damaging 1.00
R6246:Ccdc114 UTSW 7 45936364 missense probably damaging 1.00
R6324:Ccdc114 UTSW 7 45941710 missense probably damaging 1.00
R6389:Ccdc114 UTSW 7 45948516 missense probably benign 0.32
R6542:Ccdc114 UTSW 7 45948390 missense probably benign 0.00
R7215:Ccdc114 UTSW 7 45936622 missense probably damaging 1.00
R7401:Ccdc114 UTSW 7 45942765 missense probably damaging 1.00
R7431:Ccdc114 UTSW 7 45929246 missense probably damaging 0.99
X0064:Ccdc114 UTSW 7 45948393 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CAAGGTAGCATCTTGGCAACTC -3'
(R):5'- TGGGGAAGCCTAGAGTTAGCAC -3'

Sequencing Primer
(F):5'- TAGCATCTTGGCAACTCTCCCTTTAC -3'
(R):5'- TTAGCCAAGCTGGACGC -3'
Posted On2018-06-22