Incidental Mutation 'R6593:Cpsf4l'
ID523481
Institutional Source Beutler Lab
Gene Symbol Cpsf4l
Ensembl Gene ENSMUSG00000018727
Gene Namecleavage and polyadenylation specific factor 4-like
Synonyms1500000C01Rik, 0610010C04Rik, D11Ertd636e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R6593 (G1)
Quality Score166.009
Status Validated
Chromosome11
Chromosomal Location113698172-113710017 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 113709366 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018871] [ENSMUST00000100248] [ENSMUST00000106617] [ENSMUST00000173655]
Predicted Effect probably benign
Transcript: ENSMUST00000018871
SMART Domains Protein: ENSMUSP00000018871
Gene: ENSMUSG00000018727

DomainStartEndE-ValueType
ZnF_C3H1 10 36 1.1e-2 SMART
ZnF_C3H1 38 64 4.64e-1 SMART
ZnF_C3H1 68 93 2.34e0 SMART
ZnF_C3H1 94 117 2.4e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000100248
AA Change: P42T
SMART Domains Protein: ENSMUSP00000097819
Gene: ENSMUSG00000018727
AA Change: P42T

DomainStartEndE-ValueType
low complexity region 62 74 N/A INTRINSIC
ZnF_C3H1 89 114 3.38e-1 SMART
ZnF_C3H1 115 141 1.1e-2 SMART
ZnF_C3H1 143 169 4.64e-1 SMART
ZnF_C3H1 173 197 1.36e-2 SMART
ZnF_C3H1 198 221 5.21e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106617
SMART Domains Protein: ENSMUSP00000102228
Gene: ENSMUSG00000018727

DomainStartEndE-ValueType
ZnF_C3H1 10 36 1.1e-2 SMART
ZnF_C3H1 38 64 4.64e-1 SMART
ZnF_C3H1 68 93 2.34e0 SMART
ZnF_C3H1 94 117 5.21e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151396
Predicted Effect probably benign
Transcript: ENSMUST00000173655
SMART Domains Protein: ENSMUSP00000133451
Gene: ENSMUSG00000018727

DomainStartEndE-ValueType
ZnF_C3H1 35 61 1.33e-1 SMART
ZnF_C3H1 62 88 1.1e-2 SMART
ZnF_C3H1 90 116 4.64e-1 SMART
ZnF_C3H1 120 145 2.34e0 SMART
ZnF_C3H1 146 169 5.21e-1 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 96.6%
  • 20x: 89.6%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C A 5: 8,853,491 N1047K probably benign Het
AI597479 C A 1: 43,111,248 Q173K probably damaging Het
Arhgef10 T C 8: 14,962,522 L282P probably damaging Het
Arhgef10 T C 8: 14,962,564 I296T possibly damaging Het
Atg2b A G 12: 105,644,848 S1275P probably damaging Het
Ccdc114 T A 7: 45,947,384 D378E probably damaging Het
Cep290 T C 10: 100,508,776 M485T probably benign Het
Clca3a2 A G 3: 144,808,577 probably null Het
Clcn6 C T 4: 148,010,769 S731N probably benign Het
Clic6 A G 16: 92,528,117 I388V possibly damaging Het
Ddx58 T C 4: 40,226,651 I169V probably benign Het
Dlg5 G A 14: 24,150,652 H1350Y probably benign Het
Dnase2b T C 3: 146,586,911 Y169C probably damaging Het
Elavl3 C T 9: 22,018,547 V354M possibly damaging Het
Farp2 A C 1: 93,569,940 I231L possibly damaging Het
Gcc2 T A 10: 58,271,507 M755K probably damaging Het
Gpr88 T C 3: 116,252,624 T13A unknown Het
Gstm3 T A 3: 107,968,195 N40Y probably benign Het
Krtap5-2 A T 7: 142,174,960 C328S unknown Het
Lpar1 A T 4: 58,486,605 V222E probably damaging Het
Neto2 A G 8: 85,669,546 S192P probably damaging Het
Olfr665 C T 7: 104,881,433 T242I probably damaging Het
Pcdhgb1 G T 18: 37,682,081 D542Y probably damaging Het
Phldb2 G A 16: 45,825,427 Q264* probably null Het
Ptgs2 G A 1: 150,101,033 D6N possibly damaging Het
Rasef G T 4: 73,745,090 H167N probably damaging Het
Rbbp4 A G 4: 129,322,375 L193S probably damaging Het
Sec24d T C 3: 123,353,412 F673S probably damaging Het
Slc9b1 T C 3: 135,357,458 M1T probably null Het
Stra6 A G 9: 58,151,979 T542A probably benign Het
Stt3b T C 9: 115,252,511 Y569C probably damaging Het
Traf3ip1 A G 1: 91,527,695 K626R possibly damaging Het
Washc2 T A 6: 116,259,249 I1227N probably damaging Het
Xpo7 G A 14: 70,682,362 A671V probably damaging Het
Zfp799 A G 17: 32,819,790 Y501H probably damaging Het
Other mutations in Cpsf4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Cpsf4l APN 11 113709218 intron probably benign
IGL02132:Cpsf4l APN 11 113699859 missense possibly damaging 0.84
IGL02427:Cpsf4l APN 11 113709498 utr 5 prime probably benign
R0790:Cpsf4l UTSW 11 113706408 splice site probably benign
R1700:Cpsf4l UTSW 11 113702075 missense probably benign 0.17
R1909:Cpsf4l UTSW 11 113703378 splice site probably null
R3522:Cpsf4l UTSW 11 113702493 missense probably damaging 1.00
R4830:Cpsf4l UTSW 11 113709502 utr 5 prime probably benign
R6006:Cpsf4l UTSW 11 113699927 missense probably benign 0.23
R6229:Cpsf4l UTSW 11 113708854 missense possibly damaging 0.89
R7107:Cpsf4l UTSW 11 113702489 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TCTGTGGAGGCTGAGTCAAC -3'
(R):5'- CCCCGTTAATTAGGATTAGGTGCG -3'

Sequencing Primer
(F):5'- GCTGAGTCAACGGGGTAC -3'
(R):5'- TGCGGATGGGCTATATAGGAGC -3'
Posted On2018-06-22