Incidental Mutation 'R6593:Phldb2'
ID523485
Institutional Source Beutler Lab
Gene Symbol Phldb2
Ensembl Gene ENSMUSG00000033149
Gene Namepleckstrin homology like domain, family B, member 2
SynonymsLL5b, LL5beta, C820004H04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6593 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location45746243-45953598 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 45825427 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 264 (Q264*)
Ref Sequence ENSEMBL: ENSMUSP00000123284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036355] [ENSMUST00000076333] [ENSMUST00000134802] [ENSMUST00000136405]
Predicted Effect probably null
Transcript: ENSMUST00000036355
AA Change: Q219*
SMART Domains Protein: ENSMUSP00000046496
Gene: ENSMUSG00000033149
AA Change: Q219*

DomainStartEndE-ValueType
low complexity region 267 283 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
coiled coil region 580 692 N/A INTRINSIC
coiled coil region 724 800 N/A INTRINSIC
coiled coil region 1027 1097 N/A INTRINSIC
PH 1140 1244 6.45e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000076333
AA Change: Q219*
SMART Domains Protein: ENSMUSP00000075672
Gene: ENSMUSG00000033149
AA Change: Q219*

DomainStartEndE-ValueType
low complexity region 267 283 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
coiled coil region 580 692 N/A INTRINSIC
coiled coil region 724 800 N/A INTRINSIC
low complexity region 901 913 N/A INTRINSIC
coiled coil region 1080 1150 N/A INTRINSIC
PH 1193 1297 6.45e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125433
Predicted Effect probably null
Transcript: ENSMUST00000134802
AA Change: Q264*
SMART Domains Protein: ENSMUSP00000123284
Gene: ENSMUSG00000033149
AA Change: Q264*

DomainStartEndE-ValueType
low complexity region 20 28 N/A INTRINSIC
low complexity region 312 328 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
coiled coil region 625 737 N/A INTRINSIC
coiled coil region 769 845 N/A INTRINSIC
coiled coil region 1072 1131 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136405
SMART Domains Protein: ENSMUSP00000121800
Gene: ENSMUSG00000033149

DomainStartEndE-ValueType
low complexity region 16 24 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 96.6%
  • 20x: 89.6%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C A 5: 8,853,491 N1047K probably benign Het
AI597479 C A 1: 43,111,248 Q173K probably damaging Het
Arhgef10 T C 8: 14,962,522 L282P probably damaging Het
Arhgef10 T C 8: 14,962,564 I296T possibly damaging Het
Atg2b A G 12: 105,644,848 S1275P probably damaging Het
Ccdc114 T A 7: 45,947,384 D378E probably damaging Het
Cep290 T C 10: 100,508,776 M485T probably benign Het
Clca3a2 A G 3: 144,808,577 probably null Het
Clcn6 C T 4: 148,010,769 S731N probably benign Het
Clic6 A G 16: 92,528,117 I388V possibly damaging Het
Cpsf4l G T 11: 113,709,366 probably benign Het
Ddx58 T C 4: 40,226,651 I169V probably benign Het
Dlg5 G A 14: 24,150,652 H1350Y probably benign Het
Dnase2b T C 3: 146,586,911 Y169C probably damaging Het
Elavl3 C T 9: 22,018,547 V354M possibly damaging Het
Farp2 A C 1: 93,569,940 I231L possibly damaging Het
Gcc2 T A 10: 58,271,507 M755K probably damaging Het
Gpr88 T C 3: 116,252,624 T13A unknown Het
Gstm3 T A 3: 107,968,195 N40Y probably benign Het
Krtap5-2 A T 7: 142,174,960 C328S unknown Het
Lpar1 A T 4: 58,486,605 V222E probably damaging Het
Neto2 A G 8: 85,669,546 S192P probably damaging Het
Olfr665 C T 7: 104,881,433 T242I probably damaging Het
Pcdhgb1 G T 18: 37,682,081 D542Y probably damaging Het
Ptgs2 G A 1: 150,101,033 D6N possibly damaging Het
Rasef G T 4: 73,745,090 H167N probably damaging Het
Rbbp4 A G 4: 129,322,375 L193S probably damaging Het
Sec24d T C 3: 123,353,412 F673S probably damaging Het
Slc9b1 T C 3: 135,357,458 M1T probably null Het
Stra6 A G 9: 58,151,979 T542A probably benign Het
Stt3b T C 9: 115,252,511 Y569C probably damaging Het
Traf3ip1 A G 1: 91,527,695 K626R possibly damaging Het
Washc2 T A 6: 116,259,249 I1227N probably damaging Het
Xpo7 G A 14: 70,682,362 A671V probably damaging Het
Zfp799 A G 17: 32,819,790 Y501H probably damaging Het
Other mutations in Phldb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Phldb2 APN 16 45772254 missense probably damaging 1.00
IGL00485:Phldb2 APN 16 45757188 missense possibly damaging 0.75
IGL00544:Phldb2 APN 16 45825311 missense probably damaging 1.00
IGL00547:Phldb2 APN 16 45825535 missense probably benign 0.00
IGL00835:Phldb2 APN 16 45751456 missense probably damaging 1.00
IGL00987:Phldb2 APN 16 45763102 missense possibly damaging 0.78
IGL01102:Phldb2 APN 16 45825060 missense probably damaging 1.00
IGL01530:Phldb2 APN 16 45802729 missense probably damaging 1.00
IGL01549:Phldb2 APN 16 45774318 missense probably benign 0.00
IGL01712:Phldb2 APN 16 45751429 missense probably damaging 1.00
IGL01755:Phldb2 APN 16 45825582 missense probably damaging 0.96
IGL01823:Phldb2 APN 16 45825144 missense probably damaging 0.97
IGL02353:Phldb2 APN 16 45748779 missense probably damaging 1.00
IGL02360:Phldb2 APN 16 45748779 missense probably damaging 1.00
IGL02716:Phldb2 APN 16 45801590 missense probably damaging 0.99
R0139:Phldb2 UTSW 16 45770666 splice site probably benign
R0312:Phldb2 UTSW 16 45789047 missense probably damaging 1.00
R0379:Phldb2 UTSW 16 45781451 missense probably damaging 1.00
R0535:Phldb2 UTSW 16 45757127 missense probably damaging 1.00
R1387:Phldb2 UTSW 16 45825994 missense possibly damaging 0.69
R1444:Phldb2 UTSW 16 45757253 splice site probably benign
R1487:Phldb2 UTSW 16 45789024 missense probably damaging 1.00
R1501:Phldb2 UTSW 16 45777783 missense probably damaging 1.00
R1605:Phldb2 UTSW 16 45770779 splice site probably benign
R1716:Phldb2 UTSW 16 45775050 missense probably benign 0.01
R1732:Phldb2 UTSW 16 45757166 missense probably damaging 1.00
R1779:Phldb2 UTSW 16 45801625 missense probably damaging 1.00
R1824:Phldb2 UTSW 16 45826011 missense probably benign 0.14
R2001:Phldb2 UTSW 16 45774195 missense possibly damaging 0.66
R2066:Phldb2 UTSW 16 45770758 missense probably damaging 1.00
R2122:Phldb2 UTSW 16 45762941 missense probably damaging 0.99
R2448:Phldb2 UTSW 16 45825363 missense probably damaging 1.00
R2932:Phldb2 UTSW 16 45748785 missense possibly damaging 0.85
R3076:Phldb2 UTSW 16 45825010 missense probably benign 0.00
R3078:Phldb2 UTSW 16 45825010 missense probably benign 0.00
R3779:Phldb2 UTSW 16 45748755 missense probably damaging 1.00
R3914:Phldb2 UTSW 16 45757163 missense probably damaging 1.00
R4536:Phldb2 UTSW 16 45770681 missense probably benign 0.04
R4568:Phldb2 UTSW 16 45777718 nonsense probably null
R4798:Phldb2 UTSW 16 45825874 missense probably damaging 1.00
R4853:Phldb2 UTSW 16 45802716 missense probably damaging 0.99
R4906:Phldb2 UTSW 16 45751395 missense probably damaging 1.00
R4984:Phldb2 UTSW 16 45825633 missense probably damaging 1.00
R5078:Phldb2 UTSW 16 45777742 missense possibly damaging 0.85
R5137:Phldb2 UTSW 16 45808258 missense possibly damaging 0.85
R5237:Phldb2 UTSW 16 45747886 missense probably damaging 0.99
R5410:Phldb2 UTSW 16 45825612 missense possibly damaging 0.77
R5825:Phldb2 UTSW 16 45763097 missense probably benign 0.11
R5874:Phldb2 UTSW 16 45801625 missense probably damaging 1.00
R5907:Phldb2 UTSW 16 45825188 missense probably damaging 1.00
R6332:Phldb2 UTSW 16 45774246 missense probably benign
R6354:Phldb2 UTSW 16 45825114 missense probably damaging 1.00
R6355:Phldb2 UTSW 16 45825338 missense probably damaging 0.99
R6383:Phldb2 UTSW 16 45748750 missense probably damaging 1.00
R6463:Phldb2 UTSW 16 45774993 missense probably benign 0.37
R6513:Phldb2 UTSW 16 45747877 missense possibly damaging 0.96
R6756:Phldb2 UTSW 16 45808320 missense probably benign 0.02
R6810:Phldb2 UTSW 16 45748725 critical splice donor site probably null
R6897:Phldb2 UTSW 16 45777775 missense probably damaging 1.00
R7010:Phldb2 UTSW 16 45751505 missense probably damaging 0.99
R7142:Phldb2 UTSW 16 45757176 nonsense probably null
R7149:Phldb2 UTSW 16 45751532 nonsense probably null
R7249:Phldb2 UTSW 16 45801614 missense probably damaging 1.00
R7300:Phldb2 UTSW 16 45825562 missense probably damaging 1.00
R7328:Phldb2 UTSW 16 45758209 critical splice acceptor site probably null
R7515:Phldb2 UTSW 16 45774240 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AACTTCTTGGAGGCAGGCTG -3'
(R):5'- AGAGAAGCCTCCCTATTCCAGATAC -3'

Sequencing Primer
(F):5'- GCTGAGAGGCGACATCTG -3'
(R):5'- CCTATTCCAGATACAGCTCTAGG -3'
Posted On2018-06-22