Incidental Mutation 'R6576:Cldn15'
ID523498
Institutional Source Beutler Lab
Gene Symbol Cldn15
Ensembl Gene ENSMUSG00000001739
Gene Nameclaudin 15
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6576 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location136966616-136975858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 136974616 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 157 (E157D)
Ref Sequence ENSEMBL: ENSMUSP00000106722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001790] [ENSMUST00000111093]
Predicted Effect probably damaging
Transcript: ENSMUST00000001790
AA Change: E157D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001790
Gene: ENSMUSG00000001739
AA Change: E157D

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 2 179 6.4e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111093
AA Change: E157D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106722
Gene: ENSMUSG00000001739
AA Change: E157D

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 2 179 6.5e-36 PFAM
Pfam:Claudin_2 12 181 2.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128391
Meta Mutation Damage Score 0.0284 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 92% (34/37)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This protein increases permeability for sodium ions in anion-selective epithelial cell sheets. The gene deficiency leads to megaintestine and decreases in intestinal epithelial paracellular ion permeability. This gene is a direct target for hepatocyte-nuclear-factor-4alpha, a mediator of ion epithelial transport, and is down-modulated in inflammatory bowel disease. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and grow normally with an enlarged upper small intestinal phenotype (megaintestine) resulting from enhanced proliferation of normal cryptic cells after weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik A T 4: 62,532,605 T102S possibly damaging Het
Aff4 C A 11: 53,400,441 H743N probably damaging Het
Apba3 A G 10: 81,273,091 T563A probably benign Het
Arhgap20 T C 9: 51,849,278 S774P probably benign Het
Asap2 A G 12: 21,244,703 Y528C probably damaging Het
Cep162 A G 9: 87,217,145 S767P probably benign Het
Ces1b T A 8: 93,056,919 T558S probably benign Het
Chd8 T C 14: 52,216,076 Y1176C probably damaging Het
Col4a3 T A 1: 82,708,574 probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dnaaf3 A G 7: 4,523,380 I566T probably benign Het
Drc7 A T 8: 95,075,258 I716F probably damaging Het
Epp13 G A 7: 6,277,542 probably benign Het
Fam35a T C 14: 34,268,242 T236A probably damaging Het
Fat3 G A 9: 16,377,210 T339I probably damaging Het
Fat4 T C 3: 38,979,690 I2497T probably benign Het
Fmo6 A G 1: 162,922,695 F264S probably damaging Het
Gtf2i T C 5: 134,263,702 D356G probably damaging Het
Id1 T C 2: 152,736,663 V108A probably benign Het
Kcnq3 T C 15: 66,025,178 D291G possibly damaging Het
Klc3 G T 7: 19,397,980 D157E possibly damaging Het
Lasp1 C T 11: 97,833,576 R94C probably damaging Het
Lmbr1 A T 5: 29,291,310 M93K probably damaging Het
Lrrc75a G A 11: 62,605,869 P289L probably damaging Het
Med11 G T 11: 70,453,170 K105N probably benign Het
Mrgprx2 A T 7: 48,482,632 I146N probably damaging Het
Mrpl20 A G 4: 155,806,914 I69V probably benign Het
Pik3c3 A G 18: 30,342,741 probably benign Het
Rad54b T A 4: 11,601,577 N377K probably benign Het
Rilp A G 11: 75,512,392 probably null Het
Ripk2 A T 4: 16,131,558 probably null Het
Rnf167 A C 11: 70,649,762 K156T possibly damaging Het
Snx29 T C 16: 11,715,056 probably null Het
Sox6 T A 7: 115,701,702 I177F probably damaging Het
Tln1 A T 4: 43,555,419 probably null Het
Unc13a T A 8: 71,653,478 T661S probably benign Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r87 G A 10: 130,478,785 L311F probably benign Het
Wdr64 G T 1: 175,805,928 S915I possibly damaging Het
Xpo5 T A 17: 46,240,808 probably null Het
Zswim8 T C 14: 20,721,874 V1548A probably benign Het
Other mutations in Cldn15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02706:Cldn15 APN 5 136974831 missense probably benign 0.00
R0395:Cldn15 UTSW 5 136968198 missense possibly damaging 0.91
R2112:Cldn15 UTSW 5 136968162 missense possibly damaging 0.93
R4647:Cldn15 UTSW 5 136974483 missense probably damaging 1.00
R6383:Cldn15 UTSW 5 136968125 missense probably benign 0.07
R6596:Cldn15 UTSW 5 136974679 nonsense probably null
R7285:Cldn15 UTSW 5 136972473 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTTCTCCAGGAGCCTGTGG -3'
(R):5'- CAACCGTAGAAGGCTTGTAGG -3'

Sequencing Primer
(F):5'- CAGGAGCCTGTGGGATGG -3'
(R):5'- CCGTAGAAGGCTTGTAGGGAAGC -3'
Posted On2018-06-22