Mutagenetix > Incidental Mutation

Incidental Mutation 'R6577:Cntnap2'

523538

Institutional Source

Beutler Lab

Gene Symbol

Cntnap2

Ensembl Gene

ENSMUSG00000039419

Gene Name

contactin associated protein-like 2

Synonyms

Caspr2, 5430425M22Rik

MMRRC Submission

044701-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6577 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

45036995-47278330 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 46147206 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 484 (T484I)

Ref Sequence

ENSEMBL: ENSMUSP00000110288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114641]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000114641
AA Change: T484I

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: T484I

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	34	181	3.99e-22	SMART
LamG	208	345	5.5e-34	SMART
LamG	393	529	3.31e-28	SMART
EGF	557	591	5.04e-2	SMART
Blast:FBG	594	777	7e-68	BLAST
LamG	819	945	5.58e-35	SMART
EGF	966	1002	2.11e1	SMART
LamG	1048	1188	3.55e-28	SMART
low complexity region	1263	1273	N/A	INTRINSIC
4.1m	1283	1301	4.21e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196561

Meta Mutation Damage Score

0.0988

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 93.1%

Validation Efficiency

97% (38/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Api5	T	C	2: 94,252,726 (GRCm39)	Y348C	probably benign	Het
Ark2n	T	C	18: 77,740,855 (GRCm39)	T285A	probably benign	Het
Arl14	A	G	3: 69,130,405 (GRCm39)	E184G	probably benign	Het
Asap3	T	C	4: 135,965,541 (GRCm39)		probably null	Het
Atp11b	T	A	3: 35,893,311 (GRCm39)	V36E	probably damaging	Het
Atp13a4	C	T	16: 29,298,659 (GRCm39)	S100N	probably benign	Het
Cd27	T	C	6: 125,213,756 (GRCm39)	T34A	probably benign	Het
Clec10a	T	C	11: 70,061,436 (GRCm39)	S274P	probably benign	Het
Cpsf1	CCCCTGCATGAGGCAGGTCCC	CCCC	15: 76,481,655 (GRCm39)		probably null	Het
Cracd	A	T	5: 77,013,947 (GRCm39)		probably benign	Het
Def8	T	C	8: 124,183,449 (GRCm39)	S304P	probably benign	Het
Dgkd	G	A	1: 87,867,962 (GRCm39)	V299M	probably damaging	Het
Ephb2	T	C	4: 136,384,861 (GRCm39)	D850G	probably damaging	Het
Gjd3	T	C	11: 102,691,130 (GRCm39)	N291S	possibly damaging	Het
Hc	T	C	2: 34,922,138 (GRCm39)	I563V	probably benign	Het
Hells	C	T	19: 38,919,909 (GRCm39)	Q20*	probably null	Het
Hid1	G	C	11: 115,245,462 (GRCm39)	P448A	possibly damaging	Het
Igkv8-24	C	T	6: 70,193,947 (GRCm39)	R87H	possibly damaging	Het
Irf6	A	G	1: 192,851,662 (GRCm39)	S418G	probably damaging	Het
Kcnv2	T	A	19: 27,301,420 (GRCm39)	C424S	possibly damaging	Het
Lmln	T	A	16: 32,927,370 (GRCm39)		probably null	Het
Myo1a	A	T	10: 127,551,189 (GRCm39)	I678F	possibly damaging	Het
Nup98	A	C	7: 101,778,053 (GRCm39)		probably null	Het
Papolg	GGACTTGGGATACTTACGCTTTG	GG	11: 23,829,857 (GRCm39)		probably benign	Het
Ppfibp1	T	A	6: 146,901,153 (GRCm39)		probably null	Het
Sardh	T	C	2: 27,108,867 (GRCm39)	T623A	possibly damaging	Het
Scml4	A	G	10: 42,823,107 (GRCm39)	N251D	probably damaging	Het
Skap1	T	C	11: 96,416,870 (GRCm39)	Y52H	probably damaging	Het
Srp68	G	A	11: 116,156,290 (GRCm39)	R113W	probably damaging	Het
Srsf12	T	C	4: 33,209,196 (GRCm39)		probably benign	Het
Stat5b	A	G	11: 100,688,526 (GRCm39)	M312T	probably benign	Het
Tma7	T	C	9: 108,911,262 (GRCm39)		probably benign	Het
Tmem120b	T	G	5: 123,254,710 (GRCm39)	F304V	probably damaging	Het
Tns3	G	A	11: 8,499,057 (GRCm39)	L9F	probably damaging	Het
Tns3	G	T	11: 8,499,058 (GRCm39)	D8E	probably damaging	Het
Tsc2	C	T	17: 24,829,473 (GRCm39)	A765T	probably damaging	Het
Tut7	C	T	13: 59,955,975 (GRCm39)	C45Y	probably damaging	Het
Uba1y	A	G	Y: 825,465 (GRCm39)	I276V	probably benign	Homo
Upb1	T	G	10: 75,248,723 (GRCm39)	L81R	probably damaging	Het
Uros	C	A	7: 133,302,569 (GRCm39)	C73F	probably damaging	Het
Zfp820	T	C	17: 22,038,384 (GRCm39)	I315V	probably benign	Het

Other mutations in Cntnap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cntnap2	APN	6	45,992,197 (GRCm39)	missense	possibly damaging	0.92
IGL00657:Cntnap2	APN	6	46,965,721 (GRCm39)	missense	probably damaging	0.98
IGL00846:Cntnap2	APN	6	47,169,972 (GRCm39)	missense	probably benign	0.12
IGL00851:Cntnap2	APN	6	46,461,006 (GRCm39)	missense	probably benign
IGL00857:Cntnap2	APN	6	47,026,358 (GRCm39)	missense	probably benign	0.00
IGL01290:Cntnap2	APN	6	45,992,399 (GRCm39)	missense	probably benign	0.06
IGL01445:Cntnap2	APN	6	47,169,947 (GRCm39)	missense	probably benign	0.14
IGL01468:Cntnap2	APN	6	47,248,305 (GRCm39)	nonsense	probably null
IGL01859:Cntnap2	APN	6	46,965,655 (GRCm39)	missense	probably damaging	1.00
IGL02092:Cntnap2	APN	6	46,211,137 (GRCm39)	missense	probably damaging	1.00
IGL02239:Cntnap2	APN	6	46,998,588 (GRCm39)	missense	probably damaging	0.99
IGL02508:Cntnap2	APN	6	46,211,254 (GRCm39)	missense	probably damaging	1.00
IGL02530:Cntnap2	APN	6	46,998,670 (GRCm39)	missense	possibly damaging	0.48
IGL03013:Cntnap2	APN	6	47,072,483 (GRCm39)	missense	possibly damaging	0.66
BB004:Cntnap2	UTSW	6	47,072,621 (GRCm39)	missense	possibly damaging	0.93
BB014:Cntnap2	UTSW	6	47,072,621 (GRCm39)	missense	possibly damaging	0.93
IGL02802:Cntnap2	UTSW	6	46,147,179 (GRCm39)	missense	probably damaging	1.00
R0001:Cntnap2	UTSW	6	46,507,105 (GRCm39)	missense	probably benign	0.04
R0007:Cntnap2	UTSW	6	45,969,007 (GRCm39)	missense	possibly damaging	0.95
R0007:Cntnap2	UTSW	6	45,969,007 (GRCm39)	missense	possibly damaging	0.95
R0043:Cntnap2	UTSW	6	46,460,917 (GRCm39)	missense	probably benign	0.01
R0118:Cntnap2	UTSW	6	45,037,326 (GRCm39)	splice site	probably null
R0352:Cntnap2	UTSW	6	45,969,018 (GRCm39)	splice site	probably null
R0389:Cntnap2	UTSW	6	45,986,571 (GRCm39)	missense	probably benign	0.06
R0482:Cntnap2	UTSW	6	45,692,750 (GRCm39)	missense	probably benign	0.00
R0530:Cntnap2	UTSW	6	46,506,839 (GRCm39)	nonsense	probably null
R0611:Cntnap2	UTSW	6	47,072,483 (GRCm39)	missense	possibly damaging	0.66
R0630:Cntnap2	UTSW	6	46,965,694 (GRCm39)	missense	probably damaging	0.99
R0636:Cntnap2	UTSW	6	47,273,642 (GRCm39)	splice site	probably benign
R0976:Cntnap2	UTSW	6	47,248,164 (GRCm39)	missense	probably damaging	1.00
R1195:Cntnap2	UTSW	6	46,460,902 (GRCm39)	missense	probably benign
R1195:Cntnap2	UTSW	6	46,460,902 (GRCm39)	missense	probably benign
R1195:Cntnap2	UTSW	6	46,460,902 (GRCm39)	missense	probably benign
R1387:Cntnap2	UTSW	6	47,084,848 (GRCm39)	missense	probably benign	0.19
R1524:Cntnap2	UTSW	6	46,507,613 (GRCm39)	missense	probably damaging	1.00
R1609:Cntnap2	UTSW	6	45,992,264 (GRCm39)	missense	probably benign	0.13
R1716:Cntnap2	UTSW	6	47,084,826 (GRCm39)	nonsense	probably null
R1757:Cntnap2	UTSW	6	46,736,763 (GRCm39)	missense	probably damaging	1.00
R1809:Cntnap2	UTSW	6	46,965,609 (GRCm39)	missense	probably damaging	0.99
R1813:Cntnap2	UTSW	6	46,507,567 (GRCm39)	missense	probably damaging	1.00
R2103:Cntnap2	UTSW	6	47,275,522 (GRCm39)	missense	probably damaging	1.00
R2133:Cntnap2	UTSW	6	47,275,379 (GRCm39)	missense	probably damaging	1.00
R3037:Cntnap2	UTSW	6	45,992,200 (GRCm39)	missense	possibly damaging	0.57
R3899:Cntnap2	UTSW	6	45,968,837 (GRCm39)	missense	probably benign	0.00
R4027:Cntnap2	UTSW	6	46,833,062 (GRCm39)	missense	probably benign
R4030:Cntnap2	UTSW	6	46,833,062 (GRCm39)	missense	probably benign
R4237:Cntnap2	UTSW	6	46,507,324 (GRCm39)	intron	probably benign
R4445:Cntnap2	UTSW	6	46,736,785 (GRCm39)	missense	probably benign	0.01
R4737:Cntnap2	UTSW	6	45,037,251 (GRCm39)	missense	possibly damaging	0.65
R4740:Cntnap2	UTSW	6	45,037,251 (GRCm39)	missense	possibly damaging	0.65
R4915:Cntnap2	UTSW	6	46,506,969 (GRCm39)	intron	probably benign
R4918:Cntnap2	UTSW	6	46,506,969 (GRCm39)	intron	probably benign
R4999:Cntnap2	UTSW	6	45,897,768 (GRCm39)	missense	probably damaging	0.96
R5373:Cntnap2	UTSW	6	47,084,903 (GRCm39)	missense	probably benign	0.00
R5374:Cntnap2	UTSW	6	47,084,903 (GRCm39)	missense	probably benign	0.00
R5742:Cntnap2	UTSW	6	45,897,860 (GRCm39)	nonsense	probably null
R5748:Cntnap2	UTSW	6	45,692,818 (GRCm39)	missense	probably damaging	1.00
R5765:Cntnap2	UTSW	6	46,506,749 (GRCm39)	intron	probably benign
R6118:Cntnap2	UTSW	6	47,170,011 (GRCm39)	missense	possibly damaging	0.81
R6181:Cntnap2	UTSW	6	46,736,742 (GRCm39)	missense	probably damaging	1.00
R6189:Cntnap2	UTSW	6	47,248,232 (GRCm39)	missense	probably damaging	1.00
R6262:Cntnap2	UTSW	6	45,037,046 (GRCm39)	splice site	probably null
R6385:Cntnap2	UTSW	6	46,833,114 (GRCm39)	missense	probably benign	0.00
R6555:Cntnap2	UTSW	6	46,736,694 (GRCm39)	missense	probably damaging	1.00
R6610:Cntnap2	UTSW	6	45,992,191 (GRCm39)	missense	probably benign	0.08
R6761:Cntnap2	UTSW	6	47,026,307 (GRCm39)	missense	probably benign	0.03
R7125:Cntnap2	UTSW	6	46,965,580 (GRCm39)	missense	probably benign	0.12
R7329:Cntnap2	UTSW	6	47,248,205 (GRCm39)	missense	possibly damaging	0.94
R7502:Cntnap2	UTSW	6	46,460,963 (GRCm39)	missense	possibly damaging	0.83
R7927:Cntnap2	UTSW	6	47,072,621 (GRCm39)	missense	possibly damaging	0.93
R8057:Cntnap2	UTSW	6	46,324,079 (GRCm39)	missense	probably damaging	0.98
R8261:Cntnap2	UTSW	6	47,072,627 (GRCm39)	missense	probably damaging	0.98
R8356:Cntnap2	UTSW	6	47,026,307 (GRCm39)	missense	probably benign	0.03
R8479:Cntnap2	UTSW	6	46,736,707 (GRCm39)	missense	probably benign	0.14
R8503:Cntnap2	UTSW	6	45,968,975 (GRCm39)	missense	probably damaging	1.00
R8698:Cntnap2	UTSW	6	47,026,156 (GRCm39)	missense	probably damaging	1.00
R8719:Cntnap2	UTSW	6	45,978,161 (GRCm39)	missense	probably damaging	1.00
R8816:Cntnap2	UTSW	6	46,833,076 (GRCm39)	missense	possibly damaging	0.72
R8987:Cntnap2	UTSW	6	46,460,983 (GRCm39)	missense	probably benign	0.01
R9000:Cntnap2	UTSW	6	46,461,139 (GRCm39)	intron	probably benign
R9209:Cntnap2	UTSW	6	47,026,183 (GRCm39)	missense	probably damaging	1.00
R9253:Cntnap2	UTSW	6	45,978,112 (GRCm39)	missense	probably benign	0.00
R9310:Cntnap2	UTSW	6	45,978,281 (GRCm39)	missense	probably damaging	1.00
R9395:Cntnap2	UTSW	6	45,978,244 (GRCm39)	missense	probably damaging	0.98
R9462:Cntnap2	UTSW	6	46,211,217 (GRCm39)	missense	probably damaging	0.99
R9526:Cntnap2	UTSW	6	45,992,165 (GRCm39)	missense	probably damaging	1.00
R9600:Cntnap2	UTSW	6	45,969,009 (GRCm39)	missense	probably damaging	0.98
R9621:Cntnap2	UTSW	6	46,965,726 (GRCm39)	missense	probably damaging	0.98
R9738:Cntnap2	UTSW	6	45,992,373 (GRCm39)	frame shift	probably null
R9745:Cntnap2	UTSW	6	46,211,100 (GRCm39)	missense	probably benign	0.01
R9775:Cntnap2	UTSW	6	47,026,261 (GRCm39)	missense	probably damaging	1.00
RF022:Cntnap2	UTSW	6	46,998,599 (GRCm39)	missense	probably damaging	1.00
X0018:Cntnap2	UTSW	6	45,986,452 (GRCm39)	missense	possibly damaging	0.53
X0063:Cntnap2	UTSW	6	46,998,688 (GRCm39)	missense	possibly damaging	0.92
X0066:Cntnap2	UTSW	6	46,211,179 (GRCm39)	missense	probably benign	0.03
Z1176:Cntnap2	UTSW	6	47,248,082 (GRCm39)	missense	probably benign	0.00
Z1177:Cntnap2	UTSW	6	45,992,233 (GRCm39)	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- CCGTAACTTTCAGCCACAAG -3'
(R):5'- GCACTTTGCATCTTTTATCCTAAGG -3'

Sequencing Primer
(F):5'- TTTCAGCCACAAGAATTCCCTG -3'
(R):5'- AAGGCCTACTGGGTTCCTTCAG -3'

Posted On

2018-06-22