Incidental Mutation 'R6577:Papolg'
ID523549
Institutional Source Beutler Lab
Gene Symbol Papolg
Ensembl Gene ENSMUSG00000020273
Gene Namepoly(A) polymerase gamma
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R6577 (G1)
Quality Score217.468
Status Validated
Chromosome11
Chromosomal Location23862646-23895253 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) GGACTTGGGATACTTACGCTTTG to GG at 23879857 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020513] [ENSMUST00000102863]
Predicted Effect probably benign
Transcript: ENSMUST00000020513
SMART Domains Protein: ENSMUSP00000020513
Gene: ENSMUSG00000020273

DomainStartEndE-ValueType
Pfam:PAP_central 20 363 1.4e-118 PFAM
Pfam:NTP_transf_2 53 174 2.8e-15 PFAM
Pfam:PAP_RNA-bind 365 431 2.4e-22 PFAM
Pfam:PAP_RNA-bind 421 506 1.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102863
SMART Domains Protein: ENSMUSP00000099927
Gene: ENSMUSG00000020273

DomainStartEndE-ValueType
Pfam:PAP_central 16 364 1.5e-111 PFAM
Pfam:NTP_transf_2 89 174 9.2e-12 PFAM
Pfam:PAP_RNA-bind 365 429 6.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150711
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 93.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(A) polymerase family which catalyzes template-independent extension of the 3' end of a DNA/RNA strand. This enzyme shares 60% identity to the well characterized poly(A) polymerase II (PAPII) at the amino acid level. These two enzymes have similar organization of structural and functional domains. This enzyme is exclusively localized in the nucleus and exhibits both nonspecific and CPSF (cleavage and polyadenylation specificity factor)/AAUAAA-dependent polyadenylation activity. This gene is located on chromosome 2 in contrast to the PAPII gene, which is located on chromosome 14. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik T C 18: 77,653,159 T285A probably benign Het
Api5 T C 2: 94,422,381 Y348C probably benign Het
Arl14 A G 3: 69,223,072 E184G probably benign Het
Asap3 T C 4: 136,238,230 probably null Het
Atp11b T A 3: 35,839,162 V36E probably damaging Het
Atp13a4 C T 16: 29,479,841 S100N probably benign Het
C530008M17Rik A T 5: 76,866,100 probably benign Het
Cd27 T C 6: 125,236,793 T34A probably benign Het
Clec10a T C 11: 70,170,610 S274P probably benign Het
Cntnap2 C T 6: 46,170,272 T484I probably benign Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Def8 T C 8: 123,456,710 S304P probably benign Het
Dgkd G A 1: 87,940,240 V299M probably damaging Het
Ephb2 T C 4: 136,657,550 D850G probably damaging Het
Gjc1 T C 11: 102,800,304 N291S possibly damaging Het
Hc T C 2: 35,032,126 I563V probably benign Het
Hells C T 19: 38,931,465 Q20* probably null Het
Hid1 G C 11: 115,354,636 P448A possibly damaging Het
Igkv8-24 C T 6: 70,216,963 R87H possibly damaging Het
Irf6 A G 1: 193,169,354 S418G probably damaging Het
Kcnv2 T A 19: 27,324,020 C424S possibly damaging Het
Lmln T A 16: 33,107,000 probably null Het
Myo1a A T 10: 127,715,320 I678F possibly damaging Het
Nup98 A C 7: 102,128,846 probably null Het
Ppfibp1 T A 6: 146,999,655 probably null Het
Sardh T C 2: 27,218,855 T623A possibly damaging Het
Scml4 A G 10: 42,947,111 N251D probably damaging Het
Skap1 T C 11: 96,526,044 Y52H probably damaging Het
Srp68 G A 11: 116,265,464 R113W probably damaging Het
Srsf12 T C 4: 33,209,196 probably benign Het
Stat5b A G 11: 100,797,700 M312T probably benign Het
Tma7 T C 9: 109,082,194 probably benign Het
Tmem120b T G 5: 123,116,647 F304V probably damaging Het
Tns3 G A 11: 8,549,057 L9F probably damaging Het
Tns3 G T 11: 8,549,058 D8E probably damaging Het
Tsc2 C T 17: 24,610,499 A765T probably damaging Het
Uba1y A G Y: 825,465 I276V probably benign Homo
Upb1 T G 10: 75,412,889 L81R probably damaging Het
Uros C A 7: 133,700,840 C73F probably damaging Het
Zcchc6 C T 13: 59,808,161 C45Y probably damaging Het
Zfp820 T C 17: 21,819,403 I315V probably benign Het
Other mutations in Papolg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Papolg APN 11 23876377 missense possibly damaging 0.93
IGL01016:Papolg APN 11 23885570 missense possibly damaging 0.58
IGL01394:Papolg APN 11 23867235 missense probably benign
IGL01710:Papolg APN 11 23864026 missense probably damaging 0.99
IGL01786:Papolg APN 11 23874488 missense probably damaging 1.00
IGL02008:Papolg APN 11 23879898 missense probably damaging 1.00
IGL02127:Papolg APN 11 23870870 unclassified probably benign
IGL02329:Papolg APN 11 23891869 missense probably damaging 0.98
IGL02535:Papolg APN 11 23890245 missense probably benign 0.00
IGL02588:Papolg APN 11 23890252 missense probably damaging 1.00
IGL03058:Papolg APN 11 23895029 missense probably benign 0.00
IGL03301:Papolg APN 11 23874503 missense probably benign 0.05
R0124:Papolg UTSW 11 23867535 missense probably benign 0.21
R0369:Papolg UTSW 11 23872425 critical splice donor site probably null
R0454:Papolg UTSW 11 23879868 splice site probably null
R0743:Papolg UTSW 11 23870818 unclassified probably null
R0931:Papolg UTSW 11 23882257 missense probably damaging 0.96
R1856:Papolg UTSW 11 23867379 missense probably benign 0.06
R1940:Papolg UTSW 11 23867279 missense probably benign 0.00
R2239:Papolg UTSW 11 23876378 missense probably damaging 0.99
R3802:Papolg UTSW 11 23876449 missense probably damaging 1.00
R4275:Papolg UTSW 11 23868378 missense probably benign
R4989:Papolg UTSW 11 23873919 splice site probably null
R5074:Papolg UTSW 11 23867331 missense possibly damaging 0.78
R5122:Papolg UTSW 11 23867501 critical splice donor site probably null
R6048:Papolg UTSW 11 23891815 missense probably benign 0.04
R6365:Papolg UTSW 11 23882290 missense probably damaging 1.00
R7117:Papolg UTSW 11 23895207 start gained probably benign
R7283:Papolg UTSW 11 23867394 missense not run
R7372:Papolg UTSW 11 23866439 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CATCGTCAAGCACTGTCTGAC -3'
(R):5'- GTCTGAAGGTTAGGAGACCATTTG -3'

Sequencing Primer
(F):5'- CGTCAAGCACTGTCTGACTATAGTG -3'
(R):5'- GGTTAGGAGACCATTTGAATTAACTG -3'
Posted On2018-06-22