Incidental Mutation 'R6611:Ccng2'
ID523563
Institutional Source Beutler Lab
Gene Symbol Ccng2
Ensembl Gene ENSMUSG00000029385
Gene Namecyclin G2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.602) question?
Stock #R6611 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location93267257-93276231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 93273343 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 237 (S237R)
Ref Sequence ENSEMBL: ENSMUSP00000113278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031331] [ENSMUST00000121127]
Predicted Effect probably benign
Transcript: ENSMUST00000031331
AA Change: S237R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000031331
Gene: ENSMUSG00000029385
AA Change: S237R

DomainStartEndE-ValueType
CYCLIN 61 147 3.06e-15 SMART
low complexity region 218 237 N/A INTRINSIC
low complexity region 295 317 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121127
AA Change: S237R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113278
Gene: ENSMUSG00000029385
AA Change: S237R

DomainStartEndE-ValueType
CYCLIN 61 147 3.06e-15 SMART
low complexity region 218 237 N/A INTRINSIC
low complexity region 295 317 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153260
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The eukaryotic cell cycle is governed by cyclin-dependent protein kinases (CDKs) whose activities are regulated by cyclins and CDK inhibitors. The 8 species of cyclins reported in mammals, cyclins A through H, share a conserved amino acid sequence of about 90 residues called the cyclin box. The amino acid sequence of cyclin G is well conserved among mammals. The nucleotide sequence of cyclin G1 and cyclin G2 are 53% identical. Unlike cyclin G1, cyclin G2 contains a C-terminal PEST protein destabilization motif, suggesting that cyclin G2 expression is tightly regulated through the cell cycle. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik A T 6: 40,966,779 T126S probably benign Het
Bex6 A G 16: 32,186,665 K97R probably benign Het
Brca2 T C 5: 150,536,193 L311P probably damaging Het
Cdc16 C A 8: 13,781,512 P582T probably benign Het
Cep112 T C 11: 108,506,551 I280T possibly damaging Het
Chd2 A G 7: 73,493,565 F527L probably damaging Het
Drc3 G T 11: 60,364,947 R120L probably damaging Het
Efcab6 T A 15: 83,892,835 R1133S possibly damaging Het
Fer1l5 T C 1: 36,406,654 V834A probably benign Het
Flnb A G 14: 7,915,318 Y1483C probably damaging Het
Fstl4 A T 11: 53,186,725 M770L probably benign Het
Gm10428 A T 11: 62,753,289 probably benign Het
Gm4788 A G 1: 139,732,390 Y666H probably damaging Het
Hmbs C A 9: 44,341,691 R15L probably damaging Het
Irx3 T C 8: 91,800,003 T358A probably damaging Het
Kmt2a T A 9: 44,849,272 I460L probably damaging Het
Mob2 G T 7: 142,009,556 F55L probably damaging Het
Muc6 G C 7: 141,640,433 probably benign Het
Ntrk2 T C 13: 59,054,414 L612P probably damaging Het
Obscn A G 11: 59,064,230 probably null Het
Olfr1106 A T 2: 87,049,233 M1K probably null Het
Olfr907 A T 9: 38,499,238 T190S probably damaging Het
Olfr984 T C 9: 40,101,020 I157V probably benign Het
Oxct2a T C 4: 123,322,847 E247G probably damaging Het
Phykpl G T 11: 51,598,354 A336S probably damaging Het
Pik3r4 T G 9: 105,644,277 L14R probably damaging Het
Pnpla1 A G 17: 28,881,047 N296S probably benign Het
Pramel7 A G 2: 87,490,049 I300T probably damaging Het
Rictor T G 15: 6,750,659 C132G probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Slc9a9 G T 9: 94,939,478 R306L probably benign Het
Smc5 A G 19: 23,228,919 V681A probably benign Het
Snap91 C T 9: 86,790,127 S646N probably benign Het
Ssh3 T C 19: 4,264,422 N368S probably damaging Het
Syne1 A T 10: 5,045,273 N8326K probably benign Het
Traf3 T G 12: 111,237,640 L21R possibly damaging Het
Ubxn11 C A 4: 134,123,599 T254K probably damaging Het
Other mutations in Ccng2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01148:Ccng2 APN 5 93270887 missense probably damaging 0.99
IGL01289:Ccng2 APN 5 93273417 missense probably null 0.88
R0133:Ccng2 UTSW 5 93273381 missense probably benign 0.15
R0266:Ccng2 UTSW 5 93271289 splice site probably benign
R0346:Ccng2 UTSW 5 93270894 missense probably damaging 1.00
R0401:Ccng2 UTSW 5 93273413 missense possibly damaging 0.52
R1087:Ccng2 UTSW 5 93273444 missense probably benign 0.17
R1373:Ccng2 UTSW 5 93271055 splice site probably benign
R1696:Ccng2 UTSW 5 93273382 missense possibly damaging 0.90
R3727:Ccng2 UTSW 5 93274951 missense probably damaging 1.00
R5395:Ccng2 UTSW 5 93269398 missense possibly damaging 0.84
R6337:Ccng2 UTSW 5 93270921 missense probably benign
R7077:Ccng2 UTSW 5 93269340 missense not run
R7140:Ccng2 UTSW 5 93268755 missense not run
Predicted Primers PCR Primer
(F):5'- TCCTGTGTAAGTAATACTTGGAGTG -3'
(R):5'- CTTTCACTTCCGTCAAAGCAAC -3'

Sequencing Primer
(F):5'- GGAGTGTTATTTCAACCAGCAGTTCC -3'
(R):5'- ACTGTAGTAGCTGCTGTG -3'
Posted On2018-06-22