Incidental Mutation 'R6611:Gm10428'
ID523601
Institutional Source Beutler Lab
Gene Symbol Gm10428
Ensembl Gene ENSMUSG00000096083
Gene Namepredicted gene 10428
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R6611 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location62753100-62753498 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to T at 62753289 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147022 (fasta)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175753
Predicted Effect unknown
Transcript: ENSMUST00000178750
AA Change: I64L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207474
Predicted Effect probably benign
Transcript: ENSMUST00000207597
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik A T 6: 40,966,779 T126S probably benign Het
Bex6 A G 16: 32,186,665 K97R probably benign Het
Brca2 T C 5: 150,536,193 L311P probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdc16 C A 8: 13,781,512 P582T probably benign Het
Cep112 T C 11: 108,506,551 I280T possibly damaging Het
Chd2 A G 7: 73,493,565 F527L probably damaging Het
Drc3 G T 11: 60,364,947 R120L probably damaging Het
Efcab6 T A 15: 83,892,835 R1133S possibly damaging Het
Fer1l5 T C 1: 36,406,654 V834A probably benign Het
Flnb A G 14: 7,915,318 Y1483C probably damaging Het
Fstl4 A T 11: 53,186,725 M770L probably benign Het
Gm4788 A G 1: 139,732,390 Y666H probably damaging Het
Hmbs C A 9: 44,341,691 R15L probably damaging Het
Irx3 T C 8: 91,800,003 T358A probably damaging Het
Kmt2a T A 9: 44,849,272 I460L probably damaging Het
Mob2 G T 7: 142,009,556 F55L probably damaging Het
Muc6 G C 7: 141,640,433 probably benign Het
Ntrk2 T C 13: 59,054,414 L612P probably damaging Het
Obscn A G 11: 59,064,230 probably null Het
Olfr1106 A T 2: 87,049,233 M1K probably null Het
Olfr907 A T 9: 38,499,238 T190S probably damaging Het
Olfr984 T C 9: 40,101,020 I157V probably benign Het
Oxct2a T C 4: 123,322,847 E247G probably damaging Het
Phykpl G T 11: 51,598,354 A336S probably damaging Het
Pik3r4 T G 9: 105,644,277 L14R probably damaging Het
Pnpla1 A G 17: 28,881,047 N296S probably benign Het
Pramel7 A G 2: 87,490,049 I300T probably damaging Het
Rictor T G 15: 6,750,659 C132G probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Slc9a9 G T 9: 94,939,478 R306L probably benign Het
Smc5 A G 19: 23,228,919 V681A probably benign Het
Snap91 C T 9: 86,790,127 S646N probably benign Het
Ssh3 T C 19: 4,264,422 N368S probably damaging Het
Syne1 A T 10: 5,045,273 N8326K probably benign Het
Traf3 T G 12: 111,237,640 L21R possibly damaging Het
Ubxn11 C A 4: 134,123,599 T254K probably damaging Het
Other mutations in Gm10428
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0630:Gm10428 UTSW 11 62753430 utr 3 prime probably benign
R1925:Gm10428 UTSW 11 62753353 utr 3 prime probably benign
R5466:Gm10428 UTSW 11 62753106 utr 3 prime probably benign
R5761:Gm10428 UTSW 11 62753343 utr 3 prime probably benign
R5788:Gm10428 UTSW 11 62753281 utr 3 prime probably benign
R5939:Gm10428 UTSW 11 62753462 utr 3 prime probably benign
R7115:Gm10428 UTSW 11 62753380 missense unknown
Predicted Primers PCR Primer
(F):5'- ACGCAAAGAAGGCCTTTCC -3'
(R):5'- ACCCGAGTCAGAGACTAGTAAG -3'

Sequencing Primer
(F):5'- GCAAAGAAGGCCTTTCCGAATTC -3'
(R):5'- CAAGCTGCTCTAAGGGGCTC -3'
Posted On2018-06-22