Incidental Mutation 'R6612:4930523C07Rik'
List |< first << previous [record 89 of 10171] next >> last >|
ID523629
Institutional Source Beutler Lab
Gene Symbol 4930523C07Rik
Ensembl Gene ENSMUSG00000090394
Gene NameRIKEN cDNA 4930523C07 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R6612 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location160044382-160080208 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 160075234 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 25 (N25H)
Ref Sequence ENSEMBL: ENSMUSP00000137410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097513]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000028061
SMART Domains Protein: ENSMUSP00000028061
Gene: ENSMUSG00000026729

DomainStartEndE-ValueType
low complexity region 60 73 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000060298
Predicted Effect probably damaging
Transcript: ENSMUST00000097513
AA Change: N25H

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137410
Gene: ENSMUSG00000090394
AA Change: N25H

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163892
SMART Domains Protein: ENSMUSP00000127485
Gene: ENSMUSG00000090394

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169600
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,692,007 D320E possibly damaging Het
Akr1c14 A T 13: 4,065,331 S87C probably benign Het
Arhgef37 T C 18: 61,494,881 T664A probably benign Het
Arsi A G 18: 60,912,456 T73A probably benign Het
Cacnb2 A T 2: 14,975,149 T274S probably benign Het
Cd244 A G 1: 171,574,104 T133A probably benign Het
Ciz1 T A 2: 32,377,311 S720T possibly damaging Het
Cxcr6 T A 9: 123,810,720 I262N probably damaging Het
Cyp2a4 T A 7: 26,308,647 F160I probably benign Het
Esrra T C 19: 6,911,852 T390A probably benign Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Gm17079 C A 14: 51,694,375 Q91H probably damaging Het
Gm17079 T A 14: 51,694,376 Q91L possibly damaging Het
Got1 A G 19: 43,504,803 S256P probably damaging Het
Gria4 C T 9: 4,472,206 V428I possibly damaging Het
Grin2b A G 6: 135,740,998 Y699H probably damaging Het
Hipk2 T C 6: 38,818,873 I154V probably benign Het
Hkdc1 T C 10: 62,395,441 E628G possibly damaging Het
Hmcn1 C G 1: 150,595,118 probably null Het
Hspbap1 T G 16: 35,801,591 L102W probably damaging Het
Iqcb1 G A 16: 36,871,661 probably benign Het
Itga7 A G 10: 128,948,993 Y763C possibly damaging Het
Itgb4 A T 11: 115,984,071 D418V probably benign Het
Jakmip2 T C 18: 43,557,367 D631G probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Kcnu1 A G 8: 25,918,316 I52V probably benign Het
Kdm5a T C 6: 120,430,228 I1468T probably damaging Het
Kmt2d A G 15: 98,845,858 probably benign Het
Mab21l3 A G 3: 101,818,645 V345A possibly damaging Het
March10 A T 11: 105,397,078 S133T probably damaging Het
Mccc1 T C 3: 35,993,930 S115G probably benign Het
Mchr1 G A 15: 81,237,870 V274M probably damaging Het
Mrgpra3 T A 7: 47,590,035 I48F probably benign Het
Myo9a T A 9: 59,827,196 F687Y probably damaging Het
Nfrkb T A 9: 31,397,006 L216* probably null Het
Nrxn3 A T 12: 89,813,332 probably benign Het
Olfr746 A T 14: 50,653,633 Y132F probably damaging Het
Olig2 T A 16: 91,226,881 M161K probably damaging Het
Pcdh15 T A 10: 74,185,378 N141K probably damaging Het
Pcdha4 T C 18: 36,954,978 V738A probably benign Het
Pdgfra T C 5: 75,167,842 S212P probably benign Het
Plk3 G A 4: 117,132,737 Q194* probably null Het
Ppp1r36 T C 12: 76,437,604 I216T possibly damaging Het
Ptprz1 T A 6: 23,052,082 N2303K probably damaging Het
Rab25 G A 3: 88,543,403 T117M probably damaging Het
Slc25a47 T C 12: 108,855,978 V231A probably benign Het
Slx4 G A 16: 3,985,276 H1225Y probably damaging Het
Snx13 C T 12: 35,106,759 A470V probably benign Het
Spa17 A G 9: 37,605,794 F101S probably benign Het
Ssh1 C T 5: 113,958,730 A217T probably benign Het
Synm G C 7: 67,733,516 T1466S probably damaging Het
Tbc1d19 A G 5: 53,809,845 E29G possibly damaging Het
Teddm2 T A 1: 153,850,445 T175S probably benign Het
Tet2 T A 3: 133,487,335 H446L possibly damaging Het
Tmem110 T A 14: 30,871,564 probably null Het
Tpm3-rs7 G T 14: 113,314,836 R54L probably benign Het
Ttc5 T A 14: 50,785,469 probably null Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Ush2a T C 1: 188,911,397 S4319P possibly damaging Het
Zbtb10 C A 3: 9,252,065 H312Q possibly damaging Het
Zfp462 A T 4: 55,012,324 probably null Het
Other mutations in 4930523C07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02545:4930523C07Rik APN 1 160075424 missense probably damaging 0.97
R1023:4930523C07Rik UTSW 1 160077487 unclassified probably benign
R1707:4930523C07Rik UTSW 1 160070802 unclassified probably benign
R2128:4930523C07Rik UTSW 1 160075375 nonsense probably null
R2129:4930523C07Rik UTSW 1 160075375 nonsense probably null
R2147:4930523C07Rik UTSW 1 160075433 missense probably benign 0.04
R4135:4930523C07Rik UTSW 1 160077522 unclassified probably benign
R4418:4930523C07Rik UTSW 1 160044802 unclassified noncoding transcript
R4431:4930523C07Rik UTSW 1 160044579 unclassified noncoding transcript
R5222:4930523C07Rik UTSW 1 160044608 unclassified noncoding transcript
R6170:4930523C07Rik UTSW 1 160075173 missense possibly damaging 0.82
R6248:4930523C07Rik UTSW 1 160075408 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ATGCCCAAACGTGAAGCTG -3'
(R):5'- GCAGTGATGGTCTCTTCTCC -3'

Sequencing Primer
(F):5'- CGTGAAGCTGAGAGAAAAATAAATTC -3'
(R):5'- CTGAGCAGAGATCCAGAGGTCTTC -3'
Posted On2018-06-22