Incidental Mutation 'R6612:Mccc1'
ID523642
Institutional Source Beutler Lab
Gene Symbol Mccc1
Ensembl Gene ENSMUSG00000027709
Gene Namemethylcrotonoyl-Coenzyme A carboxylase 1 (alpha)
Synonyms2310058B18Rik, MCCA, MCCalpha, 1810045E08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.848) question?
Stock #R6612 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location35959312-36000678 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35993930 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 115 (S115G)
Ref Sequence ENSEMBL: ENSMUSP00000143266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029259] [ENSMUST00000199113] [ENSMUST00000200162] [ENSMUST00000200163]
Predicted Effect probably benign
Transcript: ENSMUST00000029259
AA Change: S115G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029259
Gene: ENSMUSG00000027709
AA Change: S115G

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CPSase_L_chain 44 153 4.7e-50 PFAM
Pfam:ATP-grasp_4 156 337 3.7e-20 PFAM
Pfam:RimK 158 358 1e-6 PFAM
Pfam:CPSase_L_D2 159 367 2.8e-79 PFAM
Pfam:ATP-grasp_3 160 339 8.1e-9 PFAM
Pfam:Dala_Dala_lig_C 165 335 1.2e-16 PFAM
Pfam:ATP-grasp 166 337 3.7e-13 PFAM
Biotin_carb_C 379 486 7.14e-48 SMART
Pfam:Biotin_lipoyl 644 710 1.1e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198515
Predicted Effect probably benign
Transcript: ENSMUST00000199113
AA Change: S115G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000143266
Gene: ENSMUSG00000027709
AA Change: S115G

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CPSase_L_chain 44 153 3.5e-48 PFAM
Pfam:ATP-grasp_4 156 253 4.1e-10 PFAM
Pfam:CPSase_L_D2 159 253 1.2e-24 PFAM
Pfam:Dala_Dala_lig_C 165 254 1.6e-8 PFAM
Pfam:ATP-grasp 166 253 8.3e-8 PFAM
Predicted Effect silent
Transcript: ENSMUST00000200162
SMART Domains Protein: ENSMUSP00000143396
Gene: ENSMUSG00000027709

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200163
SMART Domains Protein: ENSMUSP00000143039
Gene: ENSMUSG00000027709

DomainStartEndE-ValueType
Pfam:Dala_Dala_lig_C 1 115 3.8e-8 PFAM
Pfam:ATP-grasp_4 1 117 1.5e-9 PFAM
Pfam:CPSase_L_D2 1 147 3.9e-59 PFAM
Pfam:Biotin_carb_C 159 200 1.5e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.4%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large subunit of 3-methylcrotonyl-CoA carboxylase. This enzyme functions as a heterodimer and catalyzes the carboxylation of 3-methylcrotonyl-CoA to form 3-methylglutaconyl-CoA. Mutations in this gene are associated with 3-Methylcrotonylglycinuria, an autosomal recessive disorder of leucine catabolism. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,692,007 D320E possibly damaging Het
4930523C07Rik A C 1: 160,075,234 N25H probably damaging Het
Akr1c14 A T 13: 4,065,331 S87C probably benign Het
Arhgef37 T C 18: 61,494,881 T664A probably benign Het
Arsi A G 18: 60,912,456 T73A probably benign Het
Cacnb2 A T 2: 14,975,149 T274S probably benign Het
Cd244 A G 1: 171,574,104 T133A probably benign Het
Ciz1 T A 2: 32,377,311 S720T possibly damaging Het
Cxcr6 T A 9: 123,810,720 I262N probably damaging Het
Cyp2a4 T A 7: 26,308,647 F160I probably benign Het
Esrra T C 19: 6,911,852 T390A probably benign Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Gm17079 C A 14: 51,694,375 Q91H probably damaging Het
Gm17079 T A 14: 51,694,376 Q91L possibly damaging Het
Got1 A G 19: 43,504,803 S256P probably damaging Het
Gria4 C T 9: 4,472,206 V428I possibly damaging Het
Grin2b A G 6: 135,740,998 Y699H probably damaging Het
Hipk2 T C 6: 38,818,873 I154V probably benign Het
Hkdc1 T C 10: 62,395,441 E628G possibly damaging Het
Hmcn1 C G 1: 150,595,118 probably null Het
Hspbap1 T G 16: 35,801,591 L102W probably damaging Het
Iqcb1 G A 16: 36,871,661 probably benign Het
Itga7 A G 10: 128,948,993 Y763C possibly damaging Het
Itgb4 A T 11: 115,984,071 D418V probably benign Het
Jakmip2 T C 18: 43,557,367 D631G probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Kcnu1 A G 8: 25,918,316 I52V probably benign Het
Kdm5a T C 6: 120,430,228 I1468T probably damaging Het
Kmt2d A G 15: 98,845,858 probably benign Het
Mab21l3 A G 3: 101,818,645 V345A possibly damaging Het
March10 A T 11: 105,397,078 S133T probably damaging Het
Mchr1 G A 15: 81,237,870 V274M probably damaging Het
Mrgpra3 T A 7: 47,590,035 I48F probably benign Het
Myo9a T A 9: 59,827,196 F687Y probably damaging Het
Nfrkb T A 9: 31,397,006 L216* probably null Het
Nrxn3 A T 12: 89,813,332 probably benign Het
Olfr746 A T 14: 50,653,633 Y132F probably damaging Het
Olig2 T A 16: 91,226,881 M161K probably damaging Het
Pcdh15 T A 10: 74,185,378 N141K probably damaging Het
Pcdha4 T C 18: 36,954,978 V738A probably benign Het
Pdgfra T C 5: 75,167,842 S212P probably benign Het
Plk3 G A 4: 117,132,737 Q194* probably null Het
Ppp1r36 T C 12: 76,437,604 I216T possibly damaging Het
Ptprz1 T A 6: 23,052,082 N2303K probably damaging Het
Rab25 G A 3: 88,543,403 T117M probably damaging Het
Slc25a47 T C 12: 108,855,978 V231A probably benign Het
Slx4 G A 16: 3,985,276 H1225Y probably damaging Het
Snx13 C T 12: 35,106,759 A470V probably benign Het
Spa17 A G 9: 37,605,794 F101S probably benign Het
Ssh1 C T 5: 113,958,730 A217T probably benign Het
Synm G C 7: 67,733,516 T1466S probably damaging Het
Tbc1d19 A G 5: 53,809,845 E29G possibly damaging Het
Teddm2 T A 1: 153,850,445 T175S probably benign Het
Tet2 T A 3: 133,487,335 H446L possibly damaging Het
Tmem110 T A 14: 30,871,564 probably null Het
Tpm3-rs7 G T 14: 113,314,836 R54L probably benign Het
Ttc5 T A 14: 50,785,469 probably null Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Ush2a T C 1: 188,911,397 S4319P possibly damaging Het
Zbtb10 C A 3: 9,252,065 H312Q possibly damaging Het
Zfp462 A T 4: 55,012,324 probably null Het
Other mutations in Mccc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Mccc1 APN 3 35989860 missense probably damaging 0.99
IGL01601:Mccc1 APN 3 35989952 missense probably benign 0.00
IGL01671:Mccc1 APN 3 35964460 missense probably benign
IGL01784:Mccc1 APN 3 35976748 missense probably damaging 0.99
IGL01878:Mccc1 APN 3 35975892 missense probably damaging 1.00
IGL02088:Mccc1 APN 3 35974202 missense probably damaging 1.00
IGL02709:Mccc1 APN 3 35990739 makesense probably null
IGL02932:Mccc1 APN 3 35960029 missense possibly damaging 0.86
IGL02972:Mccc1 APN 3 35985089 missense possibly damaging 0.58
IGL03145:Mccc1 APN 3 35968446 missense probably benign
P0019:Mccc1 UTSW 3 35964395 missense probably benign 0.00
R0244:Mccc1 UTSW 3 35990047 critical splice donor site probably null
R0391:Mccc1 UTSW 3 35963570 splice site probably benign
R1466:Mccc1 UTSW 3 35974286 missense probably benign 0.01
R1466:Mccc1 UTSW 3 35974286 missense probably benign 0.01
R1591:Mccc1 UTSW 3 35989857 missense probably damaging 1.00
R1663:Mccc1 UTSW 3 35978933 missense probably damaging 1.00
R1827:Mccc1 UTSW 3 35985001 missense probably damaging 1.00
R3800:Mccc1 UTSW 3 36000509 missense probably damaging 1.00
R4290:Mccc1 UTSW 3 35990068 missense probably damaging 0.98
R4291:Mccc1 UTSW 3 35990068 missense probably damaging 0.98
R4707:Mccc1 UTSW 3 35975873 missense probably damaging 0.99
R4757:Mccc1 UTSW 3 35995917 missense probably benign 0.32
R4783:Mccc1 UTSW 3 35975873 missense probably damaging 0.99
R4785:Mccc1 UTSW 3 35975873 missense probably damaging 0.99
R4798:Mccc1 UTSW 3 35985001 missense probably damaging 0.99
R4807:Mccc1 UTSW 3 35985046 missense probably damaging 1.00
R4915:Mccc1 UTSW 3 35997554 missense probably benign 0.00
R4917:Mccc1 UTSW 3 35997554 missense probably benign 0.00
R5010:Mccc1 UTSW 3 35979017 missense probably benign 0.15
R5106:Mccc1 UTSW 3 35972564 missense probably benign 0.22
R5168:Mccc1 UTSW 3 35990780 nonsense probably null
R5241:Mccc1 UTSW 3 35974196 missense probably benign 0.03
R5444:Mccc1 UTSW 3 35976742 missense probably benign 0.00
R5677:Mccc1 UTSW 3 35990048 critical splice donor site probably null
R5838:Mccc1 UTSW 3 35985082 missense possibly damaging 0.88
R5881:Mccc1 UTSW 3 35964382 missense probably benign 0.00
R6248:Mccc1 UTSW 3 35990164 missense probably damaging 1.00
R6381:Mccc1 UTSW 3 35976727 missense probably benign 0.13
R6564:Mccc1 UTSW 3 35976676 missense probably damaging 1.00
R6769:Mccc1 UTSW 3 35989843 critical splice donor site probably null
R6771:Mccc1 UTSW 3 35989843 critical splice donor site probably null
R7135:Mccc1 UTSW 3 35995818 missense not run
Predicted Primers PCR Primer
(F):5'- TTGCTTACCAAAAGACTTCAAGCG -3'
(R):5'- TTCATGGCACTGGCATTGC -3'

Sequencing Primer
(F):5'- TTCAAGCGCAGAGGATCC -3'
(R):5'- CCTGATGGGCCCAGCATTC -3'
Posted On2018-06-22