Incidental Mutation 'R6612:Mab21l3'
ID523646
Institutional Source Beutler Lab
Gene Symbol Mab21l3
Ensembl Gene ENSMUSG00000044313
Gene Namemab-21-like 3 (C. elegans)
SynonymsBC037703
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R6612 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location101813076-101848959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101818645 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 345 (V345A)
Ref Sequence ENSEMBL: ENSMUSP00000112730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061831] [ENSMUST00000118411]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061831
AA Change: V345A

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000059212
Gene: ENSMUSG00000044313
AA Change: V345A

DomainStartEndE-ValueType
Mab-21 124 422 3.17e-104 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118411
AA Change: V345A

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112730
Gene: ENSMUSG00000044313
AA Change: V345A

DomainStartEndE-ValueType
Mab-21 124 422 3.17e-104 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.4%
Validation Efficiency 95% (59/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,692,007 D320E possibly damaging Het
4930523C07Rik A C 1: 160,075,234 N25H probably damaging Het
Akr1c14 A T 13: 4,065,331 S87C probably benign Het
Arhgef37 T C 18: 61,494,881 T664A probably benign Het
Arsi A G 18: 60,912,456 T73A probably benign Het
Cacnb2 A T 2: 14,975,149 T274S probably benign Het
Cd244 A G 1: 171,574,104 T133A probably benign Het
Ciz1 T A 2: 32,377,311 S720T possibly damaging Het
Cxcr6 T A 9: 123,810,720 I262N probably damaging Het
Cyp2a4 T A 7: 26,308,647 F160I probably benign Het
Esrra T C 19: 6,911,852 T390A probably benign Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Gm17079 C A 14: 51,694,375 Q91H probably damaging Het
Gm17079 T A 14: 51,694,376 Q91L possibly damaging Het
Got1 A G 19: 43,504,803 S256P probably damaging Het
Gria4 C T 9: 4,472,206 V428I possibly damaging Het
Grin2b A G 6: 135,740,998 Y699H probably damaging Het
Hipk2 T C 6: 38,818,873 I154V probably benign Het
Hkdc1 T C 10: 62,395,441 E628G possibly damaging Het
Hmcn1 C G 1: 150,595,118 probably null Het
Hspbap1 T G 16: 35,801,591 L102W probably damaging Het
Iqcb1 G A 16: 36,871,661 probably benign Het
Itga7 A G 10: 128,948,993 Y763C possibly damaging Het
Itgb4 A T 11: 115,984,071 D418V probably benign Het
Jakmip2 T C 18: 43,557,367 D631G probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Kcnu1 A G 8: 25,918,316 I52V probably benign Het
Kdm5a T C 6: 120,430,228 I1468T probably damaging Het
Kmt2d A G 15: 98,845,858 probably benign Het
March10 A T 11: 105,397,078 S133T probably damaging Het
Mccc1 T C 3: 35,993,930 S115G probably benign Het
Mchr1 G A 15: 81,237,870 V274M probably damaging Het
Mrgpra3 T A 7: 47,590,035 I48F probably benign Het
Myo9a T A 9: 59,827,196 F687Y probably damaging Het
Nfrkb T A 9: 31,397,006 L216* probably null Het
Nrxn3 A T 12: 89,813,332 probably benign Het
Olfr746 A T 14: 50,653,633 Y132F probably damaging Het
Olig2 T A 16: 91,226,881 M161K probably damaging Het
Pcdh15 T A 10: 74,185,378 N141K probably damaging Het
Pcdha4 T C 18: 36,954,978 V738A probably benign Het
Pdgfra T C 5: 75,167,842 S212P probably benign Het
Plk3 G A 4: 117,132,737 Q194* probably null Het
Ppp1r36 T C 12: 76,437,604 I216T possibly damaging Het
Ptprz1 T A 6: 23,052,082 N2303K probably damaging Het
Rab25 G A 3: 88,543,403 T117M probably damaging Het
Slc25a47 T C 12: 108,855,978 V231A probably benign Het
Slx4 G A 16: 3,985,276 H1225Y probably damaging Het
Snx13 C T 12: 35,106,759 A470V probably benign Het
Spa17 A G 9: 37,605,794 F101S probably benign Het
Ssh1 C T 5: 113,958,730 A217T probably benign Het
Synm G C 7: 67,733,516 T1466S probably damaging Het
Tbc1d19 A G 5: 53,809,845 E29G possibly damaging Het
Teddm2 T A 1: 153,850,445 T175S probably benign Het
Tet2 T A 3: 133,487,335 H446L possibly damaging Het
Tmem110 T A 14: 30,871,564 probably null Het
Tpm3-rs7 G T 14: 113,314,836 R54L probably benign Het
Ttc5 T A 14: 50,785,469 probably null Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Ush2a T C 1: 188,911,397 S4319P possibly damaging Het
Zbtb10 C A 3: 9,252,065 H312Q possibly damaging Het
Zfp462 A T 4: 55,012,324 probably null Het
Other mutations in Mab21l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Mab21l3 APN 3 101823455 missense probably damaging 0.99
IGL01123:Mab21l3 APN 3 101835130 missense probably benign 0.06
IGL01997:Mab21l3 APN 3 101818639 missense probably damaging 0.99
IGL02423:Mab21l3 APN 3 101818729 missense probably damaging 1.00
IGL02546:Mab21l3 APN 3 101823308 missense probably damaging 1.00
R1268:Mab21l3 UTSW 3 101835047 missense possibly damaging 0.88
R1803:Mab21l3 UTSW 3 101835130 missense probably benign 0.06
R2056:Mab21l3 UTSW 3 101815153 missense possibly damaging 0.55
R2104:Mab21l3 UTSW 3 101823428 missense probably benign 0.31
R3107:Mab21l3 UTSW 3 101826796 missense probably damaging 1.00
R3405:Mab21l3 UTSW 3 101823531 missense probably damaging 1.00
R3406:Mab21l3 UTSW 3 101823531 missense probably damaging 1.00
R5715:Mab21l3 UTSW 3 101823407 missense probably benign 0.36
R7183:Mab21l3 UTSW 3 101815153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGCTGGGGTTTATGTCTC -3'
(R):5'- CCACAGTATCCAGCTTCGTG -3'

Sequencing Primer
(F):5'- TATGTCTCCAGGAGCTGAGC -3'
(R):5'- CGTTTTCAGTCCTTTGGGTTTAAC -3'
Posted On2018-06-22