Incidental Mutation 'R6505:1700010I14Rik'
List |< first << previous [record 79 of 55675] next >> last >|
ID523807
Institutional Source Beutler Lab
Gene Symbol 1700010I14Rik
Ensembl Gene ENSMUSG00000023873
Gene NameRIKEN cDNA 1700010I14 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.034) question?
Stock #R6505 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location8988333-9008319 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 9001940 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 424 (I424L)
Ref Sequence ENSEMBL: ENSMUSP00000024650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024650] [ENSMUST00000151609]
Predicted Effect probably benign
Transcript: ENSMUST00000024650
AA Change: I424L

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000024650
Gene: ENSMUSG00000023873
AA Change: I424L

DomainStartEndE-ValueType
coiled coil region 135 165 N/A INTRINSIC
Pfam:TSNAXIP1_N 239 349 6.1e-36 PFAM
low complexity region 351 364 N/A INTRINSIC
low complexity region 372 385 N/A INTRINSIC
coiled coil region 421 466 N/A INTRINSIC
low complexity region 501 519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136954
Predicted Effect probably benign
Transcript: ENSMUST00000151609
AA Change: I424L

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118841
Gene: ENSMUSG00000023873
AA Change: I424L

DomainStartEndE-ValueType
coiled coil region 135 165 N/A INTRINSIC
coiled coil region 321 370 N/A INTRINSIC
low complexity region 372 385 N/A INTRINSIC
coiled coil region 421 466 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (84/84)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C T 10: 76,449,281 A8V probably benign Het
Ago1 G A 4: 126,463,835 P16S probably benign Het
Ak5 C T 3: 152,481,669 E394K probably benign Het
Aldh7a1 T C 18: 56,526,996 Y498C probably damaging Het
Alox12 T A 11: 70,250,204 D335V probably damaging Het
Alx4 A T 2: 93,668,559 Y212F probably damaging Het
Asb16 A G 11: 102,276,477 E223G probably damaging Het
Atg9b C T 5: 24,390,577 V235M probably damaging Het
BB014433 A G 8: 15,042,304 V183A probably benign Het
Brca1 T A 11: 101,523,541 M1256L probably benign Het
Bst1 A G 5: 43,820,590 I94V probably benign Het
C3ar1 A G 6: 122,850,640 L206P probably benign Het
Cabs1 T A 5: 87,980,663 M391K possibly damaging Het
Cars C T 7: 143,565,007 R599Q probably damaging Het
Ccdc190 T A 1: 169,933,023 Y73* probably null Het
Cd177 A C 7: 24,744,246 L809W probably benign Het
Cemip C A 7: 83,951,597 G939* probably null Het
Clca3b T A 3: 144,825,259 I777F probably benign Het
Cma2 T C 14: 55,973,779 I176T probably damaging Het
Col12a1 T A 9: 79,647,605 T2064S probably damaging Het
Csf1r A G 18: 61,129,733 N860S probably damaging Het
Dab1 T A 4: 104,512,264 C3S probably benign Het
Dennd4b A G 3: 90,267,611 E50G probably damaging Het
Dis3l A T 9: 64,307,513 S925T probably benign Het
Disp1 T C 1: 183,086,512 N1448S probably benign Het
Dpp10 T C 1: 123,336,851 I747M probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ephx4 A T 5: 107,403,656 K36* probably null Het
Fam135a C T 1: 24,014,872 V1195I probably damaging Het
Fap A T 2: 62,546,603 Y234* probably null Het
Fem1c A T 18: 46,505,875 N353K possibly damaging Het
Furin C A 7: 80,393,617 R282L probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5930 A G 14: 44,331,371 *265Q probably null Het
Hcrtr1 T A 4: 130,137,586 T15S probably benign Het
Ifnar1 C T 16: 91,499,537 Q309* probably null Het
Il18r1 A T 1: 40,489,707 I304L probably benign Het
Ino80 A T 2: 119,451,441 Y185N probably damaging Het
Itgb2 G A 10: 77,559,673 C536Y probably damaging Het
Ivns1abp T C 1: 151,360,993 M435T probably benign Het
Kcnh4 T C 11: 100,757,085 N151D probably benign Het
Lama3 T C 18: 12,495,348 M1499T probably benign Het
Lamb1 A T 12: 31,323,462 T1397S possibly damaging Het
Leng1 G A 7: 3,661,212 R239* probably null Het
Map2k4 A T 11: 65,693,529 N309K possibly damaging Het
Mcm3 A G 1: 20,803,544 F784S probably damaging Het
Mrgpra9 T A 7: 47,235,136 N260I probably benign Het
Mrnip C A 11: 50,199,852 T281N possibly damaging Het
Myo9b A G 8: 71,355,857 T1715A possibly damaging Het
Nectin3 A G 16: 46,448,821 I406T possibly damaging Het
Neto1 A G 18: 86,498,574 T339A possibly damaging Het
Ntn1 T C 11: 68,213,199 D541G probably damaging Het
Nuak2 C A 1: 132,316,394 H55Q probably damaging Het
Nufip2 A G 11: 77,691,613 T118A probably benign Het
Olfr1126 T A 2: 87,457,927 V254E probably damaging Het
Olfr1155 A T 2: 87,943,174 Y151* probably null Het
Olfr19 A T 16: 16,673,920 D20E probably benign Het
Olfr213 C T 6: 116,540,600 T49M probably benign Het
Olfr266 T G 3: 106,822,322 N79T possibly damaging Het
Olfr483 T C 7: 108,103,567 V86A probably benign Het
Olfr596 C A 7: 103,309,793 A24D probably benign Het
Olfr609 T A 7: 103,492,651 T76S probably damaging Het
Olfr847 T C 9: 19,374,941 *313W probably null Het
Pcdhb5 T A 18: 37,320,880 H104Q probably benign Het
Phf11a T C 14: 59,277,537 R232G probably damaging Het
Pik3r5 C T 11: 68,492,789 T478I probably benign Het
Prkacb T A 3: 146,732,646 E380V probably damaging Het
Prl7c1 G T 13: 27,773,793 D221E probably damaging Het
Prr11 T A 11: 87,106,124 K5* probably null Het
Prrc2b G A 2: 32,222,320 G1932D probably damaging Het
Rexo1 A T 10: 80,543,011 Y1064N possibly damaging Het
Rnf182 C T 13: 43,668,671 Q233* probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Sash1 C G 10: 8,729,527 G1033A probably benign Het
Sncaip C A 18: 52,906,537 S189* probably null Het
Sorl1 T C 9: 42,071,234 Y350C probably damaging Het
Speg T C 1: 75,406,684 V1141A possibly damaging Het
Speg C A 1: 75,429,523 D3091E possibly damaging Het
Sucnr1 A T 3: 60,086,723 D224V probably benign Het
Tg G A 15: 66,759,558 A559T probably damaging Het
Tmem132d A G 5: 127,784,438 I873T probably benign Het
Tmem229a C T 6: 24,954,921 C278Y probably damaging Het
Togaram1 T C 12: 64,966,590 I205T possibly damaging Het
Usp19 T A 9: 108,496,883 L713Q probably damaging Het
Vsig10 A G 5: 117,351,759 D530G possibly damaging Het
Zfp106 A G 2: 120,534,502 S475P probably damaging Het
Other mutations in 1700010I14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:1700010I14Rik APN 17 8997105 critical splice donor site probably null
IGL01569:1700010I14Rik APN 17 8996995 missense probably benign 0.33
IGL03024:1700010I14Rik APN 17 8993632 missense probably benign 0.33
IGL03410:1700010I14Rik APN 17 9001896 missense probably damaging 1.00
R0017:1700010I14Rik UTSW 17 9008106 utr 3 prime probably benign
R0017:1700010I14Rik UTSW 17 9008106 utr 3 prime probably benign
R0324:1700010I14Rik UTSW 17 9001157 missense probably benign 0.33
R0361:1700010I14Rik UTSW 17 8992546 missense probably benign 0.39
R0482:1700010I14Rik UTSW 17 8988423 critical splice donor site probably null
R0529:1700010I14Rik UTSW 17 8992396 missense probably benign 0.32
R1102:1700010I14Rik UTSW 17 8992628 missense probably damaging 1.00
R1964:1700010I14Rik UTSW 17 8992492 missense probably damaging 0.99
R3620:1700010I14Rik UTSW 17 9008032 missense probably benign 0.15
R4259:1700010I14Rik UTSW 17 8995234 missense probably damaging 1.00
R4261:1700010I14Rik UTSW 17 8995234 missense probably damaging 1.00
R4687:1700010I14Rik UTSW 17 8992153 missense probably damaging 1.00
R4707:1700010I14Rik UTSW 17 9005712 missense probably damaging 1.00
R4839:1700010I14Rik UTSW 17 9008013 missense probably benign 0.41
R4979:1700010I14Rik UTSW 17 9001811 missense probably damaging 1.00
R5225:1700010I14Rik UTSW 17 9008007 nonsense probably null
R5383:1700010I14Rik UTSW 17 8992700 missense possibly damaging 0.86
R6031:1700010I14Rik UTSW 17 8995252 missense possibly damaging 0.85
R6031:1700010I14Rik UTSW 17 8995252 missense possibly damaging 0.85
R6736:1700010I14Rik UTSW 17 8992268 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCATACATAGTAACTGCTCTCC -3'
(R):5'- GTGTCTCCCTGTTCCAAAGC -3'

Sequencing Primer
(F):5'- AGTAACTGCTCTCCAAACGATTTC -3'
(R):5'- TGTTCCAAAGCTCTGACAGG -3'
Posted On2018-06-22