Incidental Mutation 'R6614:Mast3'
ID523838
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Namemicrotubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6614 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70778117-70805054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70781966 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 67 (I67F)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948]
Predicted Effect probably benign
Transcript: ENSMUST00000166004
AA Change: I832F

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: I832F

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191396
Predicted Effect probably benign
Transcript: ENSMUST00000211948
AA Change: I816F

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212140
AA Change: I67F

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212172
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 98% (46/47)
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T A 8: 124,861,247 probably null Het
4932415D10Rik T A 10: 82,291,648 N1843Y probably benign Het
Abca13 A T 11: 9,294,371 N2078I probably benign Het
Abcc2 A G 19: 43,819,361 I814V probably benign Het
Adamts4 A G 1: 171,256,624 R557G probably benign Het
Bysl A T 17: 47,601,842 L341Q probably damaging Het
C130026I21Rik A C 1: 85,202,060 probably null Het
Csmd1 C T 8: 17,216,787 G41D probably damaging Het
Dnah11 T C 12: 117,886,676 D4221G possibly damaging Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Dnajc21 A G 15: 10,470,263 probably null Het
Elavl1 C A 8: 4,289,818 A255S probably damaging Het
Filip1 C T 9: 79,815,839 G1166D probably damaging Het
Gm17727 A G 9: 35,777,125 W55R probably damaging Het
Gnptg T C 17: 25,235,261 Y184C probably damaging Het
Ifit3b A T 19: 34,611,519 S32C probably benign Het
Kcnh7 T G 2: 62,777,596 Y547S probably damaging Het
Lima1 G A 15: 99,783,580 A243V probably damaging Het
Ncor1 A C 11: 62,330,819 M1283R probably benign Het
Ndufv1 G A 19: 4,008,749 T253I probably benign Het
Neurog1 G T 13: 56,251,824 Q37K probably benign Het
Nol4 T G 18: 22,920,856 K200Q probably damaging Het
Obscn T C 11: 59,012,801 H7599R probably benign Het
Olfr57 C A 10: 79,035,091 C98* probably null Het
Olfr728 T A 14: 50,140,364 I92F probably damaging Het
Olfr733 T A 14: 50,299,037 I91L probably benign Het
Olfr739 C T 14: 50,425,089 T190I probably benign Het
Olfr96 T C 17: 37,225,899 V258A probably benign Het
Oog4 A G 4: 143,437,875 V362A possibly damaging Het
Oosp1 T A 19: 11,690,950 D23V probably damaging Het
P2rx3 A G 2: 85,035,199 I34T probably damaging Het
Pla2g4a A T 1: 149,842,235 V621E probably benign Het
Prpf39 T G 12: 65,042,563 V25G probably benign Het
Psd T C 19: 46,313,412 K913E probably benign Het
Ptx4 A T 17: 25,122,702 R50S possibly damaging Het
Rex2 A T 4: 147,052,561 M16L probably benign Het
Serac1 A T 17: 6,045,662 V604E probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stxbp6 T A 12: 44,861,275 T187S probably benign Het
Tg G A 15: 66,735,259 C215Y probably damaging Het
Top2b A T 14: 16,407,142 K671* probably null Het
Trmt1 G T 8: 84,689,333 V7L probably benign Het
Ttn C T 2: 76,784,830 R15102H probably benign Het
Uhrf1bp1 T A 17: 27,876,925 I70N probably benign Het
Unc79 A T 12: 102,991,430 I35F probably damaging Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 70780683 splice site probably benign
IGL01411:Mast3 APN 8 70779583 missense possibly damaging 0.50
IGL01475:Mast3 APN 8 70779530 missense probably damaging 1.00
IGL01886:Mast3 APN 8 70782139 missense possibly damaging 0.94
IGL02104:Mast3 APN 8 70787906 missense possibly damaging 0.78
IGL02236:Mast3 APN 8 70789244 missense probably benign 0.36
IGL02437:Mast3 APN 8 70780558 missense possibly damaging 0.79
IGL02704:Mast3 APN 8 70786875 missense probably damaging 1.00
IGL03155:Mast3 APN 8 70789217 missense probably damaging 1.00
IGL03366:Mast3 APN 8 70781563 nonsense probably null
R0037:Mast3 UTSW 8 70783699 critical splice donor site probably null
R0280:Mast3 UTSW 8 70783795 missense probably damaging 1.00
R0280:Mast3 UTSW 8 70787920 missense possibly damaging 0.65
R0731:Mast3 UTSW 8 70781321 missense probably damaging 1.00
R1101:Mast3 UTSW 8 70786663 missense probably damaging 1.00
R1177:Mast3 UTSW 8 70780324 missense probably damaging 1.00
R1208:Mast3 UTSW 8 70788272 unclassified probably null
R1208:Mast3 UTSW 8 70788272 unclassified probably null
R1333:Mast3 UTSW 8 70781294 missense probably damaging 1.00
R1543:Mast3 UTSW 8 70792311 missense possibly damaging 0.93
R1544:Mast3 UTSW 8 70786172 missense probably damaging 1.00
R1738:Mast3 UTSW 8 70784556 missense probably benign 0.38
R1842:Mast3 UTSW 8 70780393 missense possibly damaging 0.91
R1936:Mast3 UTSW 8 70784800 missense probably damaging 1.00
R2015:Mast3 UTSW 8 70787363 missense probably benign 0.00
R2219:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R2220:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R3711:Mast3 UTSW 8 70779607 missense probably benign 0.13
R3919:Mast3 UTSW 8 70779422 missense probably benign 0.02
R4027:Mast3 UTSW 8 70787908 missense probably damaging 1.00
R4060:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4061:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4062:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4063:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4588:Mast3 UTSW 8 70780607 nonsense probably null
R4672:Mast3 UTSW 8 70784797 frame shift probably null
R4770:Mast3 UTSW 8 70786220 missense probably damaging 1.00
R4822:Mast3 UTSW 8 70780366 missense probably damaging 1.00
R4830:Mast3 UTSW 8 70788915 missense possibly damaging 0.87
R5196:Mast3 UTSW 8 70788245 missense probably damaging 1.00
R5333:Mast3 UTSW 8 70783501 missense probably benign 0.03
R5428:Mast3 UTSW 8 70784733 missense possibly damaging 0.95
R5656:Mast3 UTSW 8 70786221 missense probably damaging 1.00
R5920:Mast3 UTSW 8 70787933 missense probably benign 0.00
R6177:Mast3 UTSW 8 70790018 missense probably damaging 1.00
R6186:Mast3 UTSW 8 70785483 missense probably damaging 1.00
R6407:Mast3 UTSW 8 70782128 missense probably benign 0.02
R6804:Mast3 UTSW 8 70786732 missense probably benign 0.29
R6873:Mast3 UTSW 8 70786592 nonsense probably null
R6930:Mast3 UTSW 8 70799471 nonsense probably null
R6948:Mast3 UTSW 8 70785482 missense probably damaging 1.00
R7084:Mast3 UTSW 8 70779473 missense probably benign 0.14
R7253:Mast3 UTSW 8 70789682 critical splice donor site probably null
R7316:Mast3 UTSW 8 70779788 missense probably damaging 1.00
R7357:Mast3 UTSW 8 70784859 missense probably damaging 1.00
R7405:Mast3 UTSW 8 70786171 missense probably damaging 1.00
R7429:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7430:Mast3 UTSW 8 70780303 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAGCTTGACACCTATCCATCTC -3'
(R):5'- AACAGGCTAAGGTCCTGGAC -3'

Sequencing Primer
(F):5'- CCCATGAAGGTAGAATGCAGGTTC -3'
(R):5'- TAAGGTCCTGGACACCTGC -3'
Posted On2018-06-22