Incidental Mutation 'R6578:Sync'
ID523847
Institutional Source Beutler Lab
Gene Symbol Sync
Ensembl Gene ENSMUSG00000001333
Gene Namesyncoilin
Synonyms1110057H03Rik, SNIP4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R6578 (G1)
Quality Score187.009
Status Validated
Chromosome4
Chromosomal Location129287617-129308559 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129294267 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 364 (L364P)
Ref Sequence ENSEMBL: ENSMUSP00000099659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102599]
Predicted Effect probably damaging
Transcript: ENSMUST00000102599
AA Change: L364P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099659
Gene: ENSMUSG00000001333
AA Change: L364P

DomainStartEndE-ValueType
low complexity region 65 75 N/A INTRINSIC
Filament 156 453 1.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146448
Meta Mutation Damage Score 0.336 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the intermediate filament family which contains an N-terminal head domain, followed by a central coiled-coil region and a short C-terminal tail. The protein is highly expressed in skeletal and cardiac muscle. The protein links the dystrophin associated protein complex (DAPC) to desmin filaments in muscle and may have a structural role in striated muscle. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygotes for one knock-out allele show reduced generation of isometric stress in skeletal muscle but a normal response to eccentric contraction-induced injury. Homozygotes for another knock-out allele show impaired contractility and increased skeletalmuscle damage under a forced exercise regime. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik G A 6: 146,953,314 R77* probably null Het
Aldh9a1 A G 1: 167,355,759 Y182C probably damaging Het
Alpk3 T A 7: 81,078,684 S521T probably benign Het
Ankzf1 A G 1: 75,197,757 R464G possibly damaging Het
Baz2b T C 2: 59,969,279 E232G possibly damaging Het
Bbs2 T C 8: 94,077,041 S524G probably null Het
Casp1 A G 9: 5,304,280 K318R probably benign Het
Clock T A 5: 76,216,709 Q853L unknown Het
Clstn3 A G 6: 124,450,704 probably null Het
Ebpl A C 14: 61,360,320 V24G probably benign Het
Erbb2 T C 11: 98,428,188 C568R probably damaging Het
Gcm2 A G 13: 41,105,678 I105T probably damaging Het
Gm7145 C T 1: 117,985,795 P136S probably damaging Het
Helb G T 10: 120,111,181 R76S probably damaging Het
Hipk4 T C 7: 27,528,387 I186T probably damaging Het
Igdcc3 A G 9: 65,182,019 D499G probably damaging Het
Krt26 T A 11: 99,334,802 Q284H probably damaging Het
Lama4 T C 10: 39,017,365 I156T probably benign Het
Mical2 T A 7: 112,311,445 F274Y probably damaging Het
Mug1 A T 6: 121,887,452 Q1436L probably benign Het
Nin A G 12: 70,061,194 V208A probably damaging Het
Olfr1181 T C 2: 88,423,144 S294G probably benign Het
Pappa T A 4: 65,156,137 N309K possibly damaging Het
Pdcd11 T C 19: 47,111,081 V873A probably benign Het
Phf14 G A 6: 11,991,997 C724Y probably damaging Het
Pik3r2 T G 8: 70,772,639 I127L probably benign Het
Polr1a T A 6: 71,976,041 M1531K possibly damaging Het
Pwwp2b T C 7: 139,256,112 C490R probably damaging Het
Rax T C 18: 65,938,667 T50A probably benign Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Sema4c C T 1: 36,550,753 V507I probably benign Het
Skint8 C T 4: 111,936,962 T183I probably benign Het
Spata16 C T 3: 26,667,548 Q73* probably null Het
Syne1 T A 10: 5,405,454 K376* probably null Het
Tanc1 C T 2: 59,795,954 R552C probably damaging Het
Tdrd6 T C 17: 43,628,961 I399V possibly damaging Het
Vps13b T C 15: 35,446,101 C455R probably damaging Het
Other mutations in Sync
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02629:Sync APN 4 129293951 missense probably damaging 0.99
PIT4354001:Sync UTSW 4 129306654 missense possibly damaging 0.71
R0017:Sync UTSW 4 129293744 missense probably damaging 1.00
R0017:Sync UTSW 4 129293744 missense probably damaging 1.00
R0242:Sync UTSW 4 129293721 missense probably damaging 1.00
R0242:Sync UTSW 4 129293721 missense probably damaging 1.00
R0825:Sync UTSW 4 129293397 missense probably benign 0.04
R0846:Sync UTSW 4 129294104 missense probably benign 0.13
R3824:Sync UTSW 4 129294363 missense possibly damaging 0.95
R4151:Sync UTSW 4 129293726 nonsense probably null
R4166:Sync UTSW 4 129306742 intron probably benign
R4760:Sync UTSW 4 129293439 missense probably benign 0.01
R5753:Sync UTSW 4 129293386 nonsense probably null
R6120:Sync UTSW 4 129293751 missense probably damaging 1.00
R6860:Sync UTSW 4 129287790 critical splice donor site probably null
R7347:Sync UTSW 4 129294306 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ATGGGCACTTTCTCCAGGAG -3'
(R):5'- TTCCCTTGAGCTAAAATATGTCCC -3'

Sequencing Primer
(F):5'- ACTTTCTCCAGGAGAGCCGAC -3'
(R):5'- GCTAAAATATGTCCCTTCAGCTGGG -3'
Posted On2018-06-22