Incidental Mutation 'R6578:1700034J05Rik'
List |< first << previous [record 79 of 32981] next >> last >|
ID523861
Institutional Source Beutler Lab
Gene Symbol 1700034J05Rik
Ensembl Gene ENSMUSG00000040163
Gene NameRIKEN cDNA 1700034J05 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.013) question?
Stock #R6578 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location146950329-146954422 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 146953314 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 77 (R77*)
Ref Sequence ENSEMBL: ENSMUSP00000107249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016631] [ENSMUST00000036592] [ENSMUST00000111622] [ENSMUST00000111623] [ENSMUST00000203730]
Predicted Effect probably benign
Transcript: ENSMUST00000016631
SMART Domains Protein: ENSMUSP00000016631
Gene: ENSMUSG00000016487

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
PDB:3QH9|A 180 256 3e-8 PDB
low complexity region 345 358 N/A INTRINSIC
low complexity region 426 441 N/A INTRINSIC
low complexity region 530 546 N/A INTRINSIC
SAM 603 670 3.06e-13 SMART
SAM 675 741 2.39e-15 SMART
SAM 763 835 7.91e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000036592
AA Change: R77*
SMART Domains Protein: ENSMUSP00000043802
Gene: ENSMUSG00000040163
AA Change: R77*

DomainStartEndE-ValueType
Pfam:DUF4640 18 301 2.7e-128 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111622
AA Change: R77*
SMART Domains Protein: ENSMUSP00000107249
Gene: ENSMUSG00000040163
AA Change: R77*

DomainStartEndE-ValueType
Pfam:DUF4640 18 300 1.3e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111623
SMART Domains Protein: ENSMUSP00000107250
Gene: ENSMUSG00000016487

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
PDB:3QH9|A 180 256 3e-8 PDB
low complexity region 272 284 N/A INTRINSIC
low complexity region 356 369 N/A INTRINSIC
low complexity region 437 452 N/A INTRINSIC
low complexity region 541 557 N/A INTRINSIC
SAM 614 681 3.06e-13 SMART
SAM 686 752 2.39e-15 SMART
SAM 774 846 7.91e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203730
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.4%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh9a1 A G 1: 167,355,759 Y182C probably damaging Het
Alpk3 T A 7: 81,078,684 S521T probably benign Het
Ankzf1 A G 1: 75,197,757 R464G possibly damaging Het
Baz2b T C 2: 59,969,279 E232G possibly damaging Het
Bbs2 T C 8: 94,077,041 S524G probably null Het
Casp1 A G 9: 5,304,280 K318R probably benign Het
Clock T A 5: 76,216,709 Q853L unknown Het
Clstn3 A G 6: 124,450,704 probably null Het
Ebpl A C 14: 61,360,320 V24G probably benign Het
Erbb2 T C 11: 98,428,188 C568R probably damaging Het
Gcm2 A G 13: 41,105,678 I105T probably damaging Het
Gm7145 C T 1: 117,985,795 P136S probably damaging Het
Helb G T 10: 120,111,181 R76S probably damaging Het
Hipk4 T C 7: 27,528,387 I186T probably damaging Het
Igdcc3 A G 9: 65,182,019 D499G probably damaging Het
Krt26 T A 11: 99,334,802 Q284H probably damaging Het
Lama4 T C 10: 39,017,365 I156T probably benign Het
Mical2 T A 7: 112,311,445 F274Y probably damaging Het
Mug1 A T 6: 121,887,452 Q1436L probably benign Het
Nin A G 12: 70,061,194 V208A probably damaging Het
Olfr1181 T C 2: 88,423,144 S294G probably benign Het
Pappa T A 4: 65,156,137 N309K possibly damaging Het
Pdcd11 T C 19: 47,111,081 V873A probably benign Het
Phf14 G A 6: 11,991,997 C724Y probably damaging Het
Pik3r2 T G 8: 70,772,639 I127L probably benign Het
Polr1a T A 6: 71,976,041 M1531K possibly damaging Het
Pwwp2b T C 7: 139,256,112 C490R probably damaging Het
Rax T C 18: 65,938,667 T50A probably benign Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Sema4c C T 1: 36,550,753 V507I probably benign Het
Skint8 C T 4: 111,936,962 T183I probably benign Het
Spata16 C T 3: 26,667,548 Q73* probably null Het
Sync T C 4: 129,294,267 L364P probably damaging Het
Syne1 T A 10: 5,405,454 K376* probably null Het
Tanc1 C T 2: 59,795,954 R552C probably damaging Het
Tdrd6 T C 17: 43,628,961 I399V possibly damaging Het
Vps13b T C 15: 35,446,101 C455R probably damaging Het
Other mutations in 1700034J05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01654:1700034J05Rik APN 6 146953340 missense probably damaging 1.00
IGL01725:1700034J05Rik APN 6 146952269 missense probably damaging 0.97
IGL01860:1700034J05Rik APN 6 146952416 missense possibly damaging 0.77
IGL01991:1700034J05Rik APN 6 146953110 missense probably benign 0.32
IGL02375:1700034J05Rik APN 6 146953315 missense possibly damaging 0.92
R0254:1700034J05Rik UTSW 6 146952404 missense probably benign 0.00
R0361:1700034J05Rik UTSW 6 146952371 missense possibly damaging 0.94
R0835:1700034J05Rik UTSW 6 146953538 intron probably benign
R1101:1700034J05Rik UTSW 6 146952411 missense possibly damaging 0.95
R1428:1700034J05Rik UTSW 6 146952411 missense possibly damaging 0.95
R1487:1700034J05Rik UTSW 6 146953379 missense probably benign 0.16
R1887:1700034J05Rik UTSW 6 146952411 missense possibly damaging 0.95
R1988:1700034J05Rik UTSW 6 146952896 missense possibly damaging 0.70
R1989:1700034J05Rik UTSW 6 146952896 missense possibly damaging 0.70
R4063:1700034J05Rik UTSW 6 146953108 missense probably benign 0.32
R6122:1700034J05Rik UTSW 6 146952252 makesense probably null
X0066:1700034J05Rik UTSW 6 146953540 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- ACAGTTTGCAGGGAGTCAG -3'
(R):5'- TGGACACTCTCAGCACCATG -3'

Sequencing Primer
(F):5'- ACAGTTTGCAGGGAGTCAGTTTTG -3'
(R):5'- TCCAGCAGTGACTACAGTAGC -3'
Posted On2018-06-22