Incidental Mutation 'R6614:Ifit3b'
ID523898
Institutional Source Beutler Lab
Gene Symbol Ifit3b
Ensembl Gene ENSMUSG00000062488
Gene Nameinterferon-induced protein with tetratricopeptide repeats 3B
SynonymsI830012O16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.033) question?
Stock #R6614 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location34607970-34613401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34611519 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 32 (S32C)
Ref Sequence ENSEMBL: ENSMUSP00000075599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076249]
Predicted Effect probably benign
Transcript: ENSMUST00000076249
AA Change: S32C

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000075599
Gene: ENSMUSG00000062488
AA Change: S32C

DomainStartEndE-ValueType
TPR 51 84 7.69e1 SMART
TPR 94 127 2.84e1 SMART
TPR 136 169 5.69e0 SMART
Blast:TPR 170 206 5e-6 BLAST
TPR 241 274 1.02e1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T A 8: 124,861,247 probably null Het
4932415D10Rik T A 10: 82,291,648 N1843Y probably benign Het
Abca13 A T 11: 9,294,371 N2078I probably benign Het
Abcc2 A G 19: 43,819,361 I814V probably benign Het
Adamts4 A G 1: 171,256,624 R557G probably benign Het
Bysl A T 17: 47,601,842 L341Q probably damaging Het
C130026I21Rik A C 1: 85,202,060 probably null Het
Csmd1 C T 8: 17,216,787 G41D probably damaging Het
Dnah11 T C 12: 117,886,676 D4221G possibly damaging Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Dnajc21 A G 15: 10,470,263 probably null Het
Elavl1 C A 8: 4,289,818 A255S probably damaging Het
Filip1 C T 9: 79,815,839 G1166D probably damaging Het
Gm17727 A G 9: 35,777,125 W55R probably damaging Het
Gnptg T C 17: 25,235,261 Y184C probably damaging Het
Kcnh7 T G 2: 62,777,596 Y547S probably damaging Het
Lima1 G A 15: 99,783,580 A243V probably damaging Het
Mast3 T A 8: 70,781,966 I67F possibly damaging Het
Ncor1 A C 11: 62,330,819 M1283R probably benign Het
Ndufv1 G A 19: 4,008,749 T253I probably benign Het
Neurog1 G T 13: 56,251,824 Q37K probably benign Het
Nol4 T G 18: 22,920,856 K200Q probably damaging Het
Obscn T C 11: 59,012,801 H7599R probably benign Het
Olfr57 C A 10: 79,035,091 C98* probably null Het
Olfr728 T A 14: 50,140,364 I92F probably damaging Het
Olfr733 T A 14: 50,299,037 I91L probably benign Het
Olfr739 C T 14: 50,425,089 T190I probably benign Het
Olfr96 T C 17: 37,225,899 V258A probably benign Het
Oog4 A G 4: 143,437,875 V362A possibly damaging Het
Oosp1 T A 19: 11,690,950 D23V probably damaging Het
P2rx3 A G 2: 85,035,199 I34T probably damaging Het
Pla2g4a A T 1: 149,842,235 V621E probably benign Het
Prpf39 T G 12: 65,042,563 V25G probably benign Het
Psd T C 19: 46,313,412 K913E probably benign Het
Ptx4 A T 17: 25,122,702 R50S possibly damaging Het
Rex2 A T 4: 147,052,561 M16L probably benign Het
Serac1 A T 17: 6,045,662 V604E probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stxbp6 T A 12: 44,861,275 T187S probably benign Het
Tg G A 15: 66,735,259 C215Y probably damaging Het
Top2b A T 14: 16,407,142 K671* probably null Het
Trmt1 G T 8: 84,689,333 V7L probably benign Het
Ttn C T 2: 76,784,830 R15102H probably benign Het
Uhrf1bp1 T A 17: 27,876,925 I70N probably benign Het
Unc79 A T 12: 102,991,430 I35F probably damaging Het
Other mutations in Ifit3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
galilee UTSW 19 34611525 missense probably benign
negev UTSW 19 34611460 missense probably benign 0.14
R1528:Ifit3b UTSW 19 34611672 missense probably benign 0.05
R1996:Ifit3b UTSW 19 34611477 missense probably damaging 1.00
R2680:Ifit3b UTSW 19 34612305 missense probably benign 0.01
R2971:Ifit3b UTSW 19 34612017 nonsense probably null
R4395:Ifit3b UTSW 19 34612551 nonsense probably null
R4719:Ifit3b UTSW 19 34612630 missense probably damaging 0.96
R4726:Ifit3b UTSW 19 34611460 missense probably benign 0.14
R5094:Ifit3b UTSW 19 34612548 missense possibly damaging 0.93
R5958:Ifit3b UTSW 19 34611742 missense probably benign 0.02
R5987:Ifit3b UTSW 19 34612198 missense probably damaging 1.00
R6381:Ifit3b UTSW 19 34612471 missense probably benign 0.00
R6662:Ifit3b UTSW 19 34611937 missense probably damaging 1.00
R6804:Ifit3b UTSW 19 34611547 missense possibly damaging 0.92
R6847:Ifit3b UTSW 19 34611525 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCTCCATCCAGTTACCATG -3'
(R):5'- TAGATCCAGGCGTAGTTTCCCC -3'

Sequencing Primer
(F):5'- CCAGTTACCATGCAAAATTAAACATC -3'
(R):5'- TGACCAGTCGGCGAATTTC -3'
Posted On2018-06-22