Incidental Mutation 'R6579:Dnajc5'
ID 523910
Institutional Source Beutler Lab
Gene Symbol Dnajc5
Ensembl Gene ENSMUSG00000000826
Gene Name DnaJ heat shock protein family (Hsp40) member C5
Synonyms Csp, 2610314I24Rik
MMRRC Submission 044703-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.124) question?
Stock # R6579 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 181162141-181194679 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 181189209 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 62 (N62D)
Ref Sequence ENSEMBL: ENSMUSP00000112066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072334] [ENSMUST00000108796] [ENSMUST00000108797] [ENSMUST00000116365] [ENSMUST00000152578]
AlphaFold P60904
Predicted Effect possibly damaging
Transcript: ENSMUST00000072334
AA Change: N62D

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072175
Gene: ENSMUSG00000000826
AA Change: N62D

DomainStartEndE-ValueType
DnaJ 14 72 9.65e-30 SMART
low complexity region 113 136 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108796
AA Change: N62D

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104424
Gene: ENSMUSG00000000826
AA Change: N62D

DomainStartEndE-ValueType
DnaJ 14 72 9.65e-30 SMART
low complexity region 113 136 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108797
AA Change: N62D

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104425
Gene: ENSMUSG00000000826
AA Change: N62D

DomainStartEndE-ValueType
DnaJ 14 72 9.65e-30 SMART
low complexity region 113 136 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000116365
AA Change: N62D

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112066
Gene: ENSMUSG00000000826
AA Change: N62D

DomainStartEndE-ValueType
DnaJ 14 72 9.65e-30 SMART
transmembrane domain 108 130 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141523
Predicted Effect possibly damaging
Transcript: ENSMUST00000152578
AA Change: N62D

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116120
Gene: ENSMUSG00000000826
AA Change: N62D

DomainStartEndE-ValueType
DnaJ 14 72 5.9e-32 SMART
transmembrane domain 108 130 N/A INTRINSIC
Meta Mutation Damage Score 0.2118 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the J protein family. J proteins function in many cellular processes by regulating the ATPase activity of 70 kDa heat shock proteins. The encoded protein plays a role in membrane trafficking and protein folding, and has been shown to have anti-neurodegenerative properties. The encoded protein is known to play a role in cystic fibrosis and Huntington's disease. A pseudogene of this gene is located on the short arm of chromosome 8. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene die within the first 3 months of live and abnormalities in their neuromuscular synapses. This results in various defects in movement and coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,161,507 (GRCm39) V80D possibly damaging Het
6330409D20Rik T C 2: 32,630,663 (GRCm39) probably benign Het
Adam15 C T 3: 89,252,936 (GRCm39) V261M probably damaging Het
Adam29 G T 8: 56,325,779 (GRCm39) T225K probably damaging Het
Ankrd52 A G 10: 128,223,011 (GRCm39) T654A probably damaging Het
AU021092 T A 16: 5,040,020 (GRCm39) I35F probably damaging Het
Cdk20 G T 13: 64,584,348 (GRCm39) Q114H probably benign Het
Col22a1 A C 15: 71,753,502 (GRCm39) S133A probably benign Het
Cyp3a44 A T 5: 145,727,516 (GRCm39) F271Y probably damaging Het
Dchs1 A T 7: 105,412,120 (GRCm39) V1332E probably benign Het
Dhrs7l A T 12: 72,668,658 (GRCm39) D117E probably benign Het
Dnai7 A T 6: 145,124,744 (GRCm39) M527K probably benign Het
Gm3045 C T 13: 56,578,103 (GRCm39) S180L probably damaging Het
Hycc1 A T 5: 24,171,381 (GRCm39) V347D possibly damaging Het
Igkv14-130 T A 6: 67,768,421 (GRCm39) Y93* probably null Het
Myo1c C T 11: 75,562,461 (GRCm39) P918S probably benign Het
Nell2 A T 15: 95,282,957 (GRCm39) Y362N possibly damaging Het
Or5an1c C T 19: 12,218,726 (GRCm39) V100I probably benign Het
Peli1 A T 11: 21,097,059 (GRCm39) T150S probably benign Het
Pkhd1 T C 1: 20,271,047 (GRCm39) T3169A probably benign Het
Polr2m T A 9: 71,393,002 (GRCm39) E26V probably damaging Het
Rhbdf2 A G 11: 116,495,289 (GRCm39) V238A probably benign Het
Rims1 G T 1: 22,496,166 (GRCm39) P820H probably damaging Het
Rnf213 A G 11: 119,327,106 (GRCm39) T1698A probably damaging Het
Scgn C T 13: 24,143,717 (GRCm39) A216T probably damaging Het
Serpina11 T A 12: 103,951,007 (GRCm39) D238V probably damaging Het
Setd2 A T 9: 110,378,846 (GRCm39) E887V possibly damaging Het
Tiam2 CGGG CGGGG 17: 3,464,897 (GRCm39) probably null Het
Trak1 C A 9: 121,272,704 (GRCm39) N197K probably benign Het
Trpm2 C T 10: 77,773,660 (GRCm39) R585Q probably benign Het
Uchl5 T A 1: 143,674,130 (GRCm39) Y211N probably damaging Het
Usf3 T A 16: 44,039,197 (GRCm39) S1226T possibly damaging Het
Utrn T C 10: 12,623,750 (GRCm39) T163A probably benign Het
Ywhaz T C 15: 36,791,166 (GRCm39) Y19C probably damaging Het
Zcchc14 T C 8: 122,331,206 (GRCm39) probably benign Het
Other mutations in Dnajc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Dnajc5 APN 2 181,189,149 (GRCm39) missense probably benign 0.01
IGL03289:Dnajc5 APN 2 181,189,260 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGAAAGTTGACAAATGAGATGC -3'
(R):5'- AAGGAACGGGTCTTTCAACATC -3'

Sequencing Primer
(F):5'- ATGCTAATGGGTAAGTATCTCTTCCC -3'
(R):5'- AGGAACGGGTCTTTCAACATCTGTAG -3'
Posted On 2018-06-22