Incidental Mutation 'R6579:Peli1'
ID523937
Institutional Source Beutler Lab
Gene Symbol Peli1
Ensembl Gene ENSMUSG00000020134
Gene Namepellino 1
SynonymsD11Ertd676e, 2810468L03Rik, A930031K15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6579 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location21091291-21150323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21147059 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 150 (T150S)
Ref Sequence ENSEMBL: ENSMUSP00000099018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093290] [ENSMUST00000101477]
Predicted Effect probably benign
Transcript: ENSMUST00000093290
AA Change: T150S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000090979
Gene: ENSMUSG00000020134
AA Change: T150S

DomainStartEndE-ValueType
Pfam:Pellino 8 418 5.4e-227 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101477
AA Change: T150S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000099018
Gene: ENSMUSG00000020134
AA Change: T150S

DomainStartEndE-ValueType
Pfam:Pellino 3 418 6.5e-241 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149675
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156122
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (36/36)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced proinflammatory cytokine production, B cell proliferation, and mortality following treatment with LPS or pIpC. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,254,224 V80D possibly damaging Het
6330409D20Rik T C 2: 32,740,651 probably benign Het
Adam15 C T 3: 89,345,629 V261M probably damaging Het
Adam29 G T 8: 55,872,744 T225K probably damaging Het
Ankrd52 A G 10: 128,387,142 T654A probably damaging Het
AU021092 T A 16: 5,222,156 I35F probably damaging Het
Casc1 A T 6: 145,179,018 M527K probably benign Het
Cdk20 G T 13: 64,436,534 Q114H probably benign Het
Col22a1 A C 15: 71,881,653 S133A probably benign Het
Cyp3a44 A T 5: 145,790,706 F271Y probably damaging Het
Dchs1 A T 7: 105,762,913 V1332E probably benign Het
Dnajc5 A G 2: 181,547,416 N62D possibly damaging Het
Fam126a A T 5: 23,966,383 V347D possibly damaging Het
Gm3045 C T 13: 56,430,290 S180L probably damaging Het
Gm4756 A T 12: 72,621,884 D117E probably benign Het
Igkv14-130 T A 6: 67,791,437 Y93* probably null Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nell2 A T 15: 95,385,076 Y362N possibly damaging Het
Olfr262 C T 19: 12,241,362 V100I probably benign Het
Pkhd1 T C 1: 20,200,823 T3169A probably benign Het
Polr2m T A 9: 71,485,720 E26V probably damaging Het
Rhbdf2 A G 11: 116,604,463 V238A probably benign Het
Rims1 G T 1: 22,425,916 P820H probably damaging Het
Rnf213 A G 11: 119,436,280 T1698A probably damaging Het
Scgn C T 13: 23,959,734 A216T probably damaging Het
Serpina11 T A 12: 103,984,748 D238V probably damaging Het
Setd2 A T 9: 110,549,778 E887V possibly damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Trak1 C A 9: 121,443,638 N197K probably benign Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Uchl5 T A 1: 143,798,392 Y211N probably damaging Het
Usf3 T A 16: 44,218,834 S1226T possibly damaging Het
Utrn T C 10: 12,748,006 T163A probably benign Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Zcchc14 T C 8: 121,604,467 probably benign Het
Other mutations in Peli1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Peli1 APN 11 21142619 missense probably damaging 0.99
IGL00484:Peli1 APN 11 21146952 missense probably damaging 1.00
IGL01393:Peli1 APN 11 21147400 missense probably benign 0.23
IGL01460:Peli1 APN 11 21146966 missense probably benign 0.03
IGL01956:Peli1 APN 11 21148501 missense probably damaging 1.00
IGL03119:Peli1 APN 11 21140560 splice site probably benign
R0242:Peli1 UTSW 11 21142602 missense probably damaging 0.97
R0242:Peli1 UTSW 11 21142602 missense probably damaging 0.97
R2029:Peli1 UTSW 11 21148110 missense probably damaging 0.99
R4207:Peli1 UTSW 11 21147115 splice site probably null
R4849:Peli1 UTSW 11 21148528 utr 3 prime probably benign
R5368:Peli1 UTSW 11 21148389 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTCCACTGTGTTCGTTGAAAC -3'
(R):5'- ATGTCTTCCACTTGGCAGCC -3'

Sequencing Primer
(F):5'- GTCGGTCAACTGAAAGTC -3'
(R):5'- TGGCAGCCTTCTCCTATAAAATC -3'
Posted On2018-06-22