Incidental Mutation 'R6579:Nell2'
ID523956
Institutional Source Beutler Lab
Gene Symbol Nell2
Ensembl Gene ENSMUSG00000022454
Gene NameNEL-like 2
SynonymsA330108N19Rik, mel91
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6579 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location95075230-95528559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95385076 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 362 (Y362N)
Ref Sequence ENSEMBL: ENSMUSP00000155490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075275] [ENSMUST00000166170] [ENSMUST00000229933] [ENSMUST00000229981]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075275
AA Change: Y362N

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074751
Gene: ENSMUSG00000022454
AA Change: Y362N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
TSPN 32 217 9.94e-64 SMART
LamG 86 216 3.97e-8 SMART
coiled coil region 242 271 N/A INTRINSIC
VWC 277 333 6.18e-10 SMART
VWC 337 398 3.57e0 SMART
EGF 403 442 2.02e-1 SMART
EGF_CA 443 484 2.8e-9 SMART
EGF_CA 485 525 9.47e-7 SMART
EGF 527 556 1.28e-3 SMART
EGF_CA 558 604 2.13e-9 SMART
EGF_like 605 644 9.39e-4 SMART
VWC 643 695 8.88e-1 SMART
VWC 703 758 1.13e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166170
AA Change: Y362N

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131665
Gene: ENSMUSG00000022454
AA Change: Y362N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
TSPN 32 217 9.94e-64 SMART
LamG 86 216 3.97e-8 SMART
coiled coil region 242 271 N/A INTRINSIC
VWC 277 333 6.18e-10 SMART
VWC 337 398 3.57e0 SMART
EGF 403 442 2.02e-1 SMART
EGF_CA 443 484 2.8e-9 SMART
EGF_CA 485 525 9.47e-7 SMART
EGF 527 556 1.28e-3 SMART
EGF_CA 558 604 2.13e-9 SMART
EGF_like 605 644 9.39e-4 SMART
VWC 643 695 8.88e-1 SMART
VWC 703 758 1.13e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000229933
AA Change: Y362N

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000229981
AA Change: Y362N

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein containing several von Willebrand factor C domains and epidermal growth factor (EGF)-like domains. The encoded protein acts as a homotrimer and is found in the cytoplasm. Several variants encoding a few different isoforms exist, and at least one isoform appears to be a secreted protein. Studies in mouse suggest that this protein plays a role in neural cell growth and differentiation as well as in oncogenesis. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous null mice display enhanced long term potentiation in the dentate gyrus of the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,254,224 V80D possibly damaging Het
6330409D20Rik T C 2: 32,740,651 probably benign Het
Adam15 C T 3: 89,345,629 V261M probably damaging Het
Adam29 G T 8: 55,872,744 T225K probably damaging Het
Ankrd52 A G 10: 128,387,142 T654A probably damaging Het
AU021092 T A 16: 5,222,156 I35F probably damaging Het
Casc1 A T 6: 145,179,018 M527K probably benign Het
Cdk20 G T 13: 64,436,534 Q114H probably benign Het
Col22a1 A C 15: 71,881,653 S133A probably benign Het
Cyp3a44 A T 5: 145,790,706 F271Y probably damaging Het
Dchs1 A T 7: 105,762,913 V1332E probably benign Het
Dnajc5 A G 2: 181,547,416 N62D possibly damaging Het
Fam126a A T 5: 23,966,383 V347D possibly damaging Het
Gm3045 C T 13: 56,430,290 S180L probably damaging Het
Gm4756 A T 12: 72,621,884 D117E probably benign Het
Igkv14-130 T A 6: 67,791,437 Y93* probably null Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Olfr262 C T 19: 12,241,362 V100I probably benign Het
Peli1 A T 11: 21,147,059 T150S probably benign Het
Pkhd1 T C 1: 20,200,823 T3169A probably benign Het
Polr2m T A 9: 71,485,720 E26V probably damaging Het
Rhbdf2 A G 11: 116,604,463 V238A probably benign Het
Rims1 G T 1: 22,425,916 P820H probably damaging Het
Rnf213 A G 11: 119,436,280 T1698A probably damaging Het
Scgn C T 13: 23,959,734 A216T probably damaging Het
Serpina11 T A 12: 103,984,748 D238V probably damaging Het
Setd2 A T 9: 110,549,778 E887V possibly damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Trak1 C A 9: 121,443,638 N197K probably benign Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Uchl5 T A 1: 143,798,392 Y211N probably damaging Het
Usf3 T A 16: 44,218,834 S1226T possibly damaging Het
Utrn T C 10: 12,748,006 T163A probably benign Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Zcchc14 T C 8: 121,604,467 probably benign Het
Other mutations in Nell2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Nell2 APN 15 95527285 missense possibly damaging 0.94
IGL00919:Nell2 APN 15 95383727 missense possibly damaging 0.88
IGL01124:Nell2 APN 15 95296179 missense probably damaging 1.00
IGL01356:Nell2 APN 15 95229183 missense probably damaging 0.99
IGL01865:Nell2 APN 15 95385081 missense possibly damaging 0.74
IGL02324:Nell2 APN 15 95229101 missense probably damaging 0.99
IGL02505:Nell2 APN 15 95296263 splice site probably benign
PIT4495001:Nell2 UTSW 15 95383727 missense probably benign 0.33
R0112:Nell2 UTSW 15 95431681 splice site probably benign
R0139:Nell2 UTSW 15 95432901 missense probably benign 0.13
R0355:Nell2 UTSW 15 95432901 missense probably benign 0.13
R0481:Nell2 UTSW 15 95432682 splice site probably null
R0535:Nell2 UTSW 15 95431607 missense probably benign 0.10
R0607:Nell2 UTSW 15 95229214 missense probably benign 0.06
R1378:Nell2 UTSW 15 95232521 missense probably damaging 1.00
R1688:Nell2 UTSW 15 95431613 missense probably damaging 0.97
R2054:Nell2 UTSW 15 95435109 missense probably benign 0.00
R2163:Nell2 UTSW 15 95429978 missense probably damaging 1.00
R2176:Nell2 UTSW 15 95435157 missense probably damaging 0.97
R3745:Nell2 UTSW 15 95432673 missense probably damaging 1.00
R5055:Nell2 UTSW 15 95473579 missense probably benign 0.00
R5184:Nell2 UTSW 15 95527809 missense possibly damaging 0.78
R5382:Nell2 UTSW 15 95229210 missense probably damaging 1.00
R6145:Nell2 UTSW 15 95473561 missense probably damaging 1.00
R6264:Nell2 UTSW 15 95346825 missense probably damaging 0.99
R6337:Nell2 UTSW 15 95385144 missense probably damaging 1.00
R6423:Nell2 UTSW 15 95527282 missense probably damaging 1.00
R6438:Nell2 UTSW 15 95232498 missense probably damaging 1.00
R6810:Nell2 UTSW 15 95241587 missense probably damaging 1.00
R6894:Nell2 UTSW 15 95346887 missense probably damaging 1.00
R7016:Nell2 UTSW 15 95229151 missense possibly damaging 0.87
R7266:Nell2 UTSW 15 95435393 missense possibly damaging 0.50
X0038:Nell2 UTSW 15 95527812 missense probably benign
Z1088:Nell2 UTSW 15 95435097 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCGTGGAAGTGTGCTCC -3'
(R):5'- TAAGGTTTACAAGTTCCTCGAAGG -3'

Sequencing Primer
(F):5'- GTGGAAGTGTGCTCCTATTTAACTAC -3'
(R):5'- TCCTCGAAGGAGACTGAATGTATG -3'
Posted On2018-06-22