Incidental Mutation 'R6615:Bean1'
ID 523961
Institutional Source Beutler Lab
Gene Symbol Bean1
Ensembl Gene ENSMUSG00000031872
Gene Name brain expressed, associated with Nedd4, 1
Synonyms
MMRRC Submission 044738-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6615 (G1)
Quality Score 214.458
Status Validated
Chromosome 8
Chromosomal Location 104897110-104945730 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) CT to C at 104908664 bp (GRCm39)
Zygosity Homozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093245] [ENSMUST00000164076] [ENSMUST00000167633] [ENSMUST00000171018] [ENSMUST00000212979] [ENSMUST00000213077]
AlphaFold Q9EQG5
Predicted Effect probably benign
Transcript: ENSMUST00000093245
SMART Domains Protein: ENSMUSP00000090931
Gene: ENSMUSG00000031872

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 70 90 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153288
Predicted Effect probably benign
Transcript: ENSMUST00000164076
SMART Domains Protein: ENSMUSP00000132056
Gene: ENSMUSG00000031872

DomainStartEndE-ValueType
low complexity region 156 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167633
SMART Domains Protein: ENSMUSP00000131530
Gene: ENSMUSG00000031872

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 70 90 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171018
SMART Domains Protein: ENSMUSP00000129403
Gene: ENSMUSG00000031872

DomainStartEndE-ValueType
transmembrane domain 72 94 N/A INTRINSIC
low complexity region 104 124 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000212979
Predicted Effect probably benign
Transcript: ENSMUST00000213077
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of several proteins that interact with NEDD4, a member of a family of ubiquitin-protein ligases. These proteins have PY motifs in common that bind to the WW domains of NEDD4. NEDD4 is developmentally regulated, and is highly expressed in embryonic tissues. Mutations in this gene (i.e., intronic insertions of >100 copies of pentanucleotide repeats including a (TGGAA)n sequence) are associated with spinocerebellar ataxia type 31. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null targeted allele are viable and fertile and exhibit no apparent abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Avl9 T C 6: 56,730,870 (GRCm39) V598A probably benign Het
Bcar3 T A 3: 122,220,282 (GRCm39) S60T probably benign Het
Calm3 A G 7: 16,651,508 (GRCm39) probably null Het
Ccdc113 A C 8: 96,272,620 (GRCm39) E242D probably benign Het
Celsr1 C T 15: 85,786,315 (GRCm39) probably null Het
Clhc1 T A 11: 29,528,149 (GRCm39) M559K possibly damaging Het
Dhx36 T A 3: 62,396,338 (GRCm39) I440L probably benign Het
Dnah7c A T 1: 46,554,599 (GRCm39) T445S probably benign Het
Dnah7c A G 1: 46,688,511 (GRCm39) S1894G probably benign Het
Dnah7c C A 1: 46,688,500 (GRCm39) T1890K probably benign Het
Dsc2 T A 18: 20,165,576 (GRCm39) H843L possibly damaging Het
F11 T C 8: 45,701,811 (GRCm39) Y333C probably benign Het
Fbxo41 T C 6: 85,455,505 (GRCm39) T560A possibly damaging Het
Fbxo7 A T 10: 85,880,398 (GRCm39) H282L possibly damaging Het
Gmnc T G 16: 26,779,278 (GRCm39) D243A probably benign Het
Hdac5 C A 11: 102,087,882 (GRCm39) probably null Het
Krt87 A G 15: 101,334,443 (GRCm39) V188A probably benign Het
Lpxn G A 19: 12,802,163 (GRCm39) V163M probably benign Het
Lrrk1 A T 7: 65,931,396 (GRCm39) L55Q probably damaging Het
Ltbp2 C T 12: 84,860,091 (GRCm39) C621Y probably damaging Het
Marchf8 A G 6: 116,382,624 (GRCm39) E147G probably damaging Het
Muc16 T G 9: 18,558,484 (GRCm39) H2603P unknown Het
Nipa1 T A 7: 55,629,571 (GRCm39) N181Y probably damaging Het
Nt5el T A 13: 105,248,993 (GRCm39) N402K probably damaging Het
Or14c45 A G 7: 86,176,120 (GRCm39) T52A probably benign Het
Or2h2c G A 17: 37,422,494 (GRCm39) P127S probably damaging Het
Or4k37 A G 2: 111,159,457 (GRCm39) D231G probably benign Het
Or51f23c-ps1 T C 7: 102,430,994 (GRCm39) F104L probably damaging Het
Or7g35 A G 9: 19,496,285 (GRCm39) I151V probably benign Het
Pcf11 T A 7: 92,307,090 (GRCm39) Q1026L probably damaging Het
Ptch1 T G 13: 63,687,644 (GRCm39) K378T possibly damaging Het
Ptprm C T 17: 67,660,951 (GRCm39) probably null Het
Pxmp2 C A 5: 110,425,573 (GRCm39) W154L possibly damaging Het
Rdh7 T G 10: 127,720,491 (GRCm39) S294R probably damaging Het
Rexo1 C T 10: 80,379,848 (GRCm39) R994Q possibly damaging Het
Sacs A G 14: 61,446,383 (GRCm39) T2810A probably benign Het
Serpina3c A T 12: 104,117,980 (GRCm39) H119Q possibly damaging Het
Slc12a2 T G 18: 58,031,200 (GRCm39) I335R probably damaging Het
Slc25a13 C T 6: 6,073,454 (GRCm39) R468Q probably damaging Het
Slc5a6 C T 5: 31,194,174 (GRCm39) V628I probably benign Het
Srsf2 T C 11: 116,743,905 (GRCm39) probably null Het
Sugp2 A G 8: 70,695,420 (GRCm39) Q131R possibly damaging Het
Syne1 T C 10: 5,251,340 (GRCm39) R2525G probably damaging Het
Tars3 T C 7: 65,327,890 (GRCm39) F533S probably damaging Het
Tmem8b G T 4: 43,682,249 (GRCm39) G82W probably damaging Het
Unc13c A G 9: 73,837,890 (GRCm39) I987T possibly damaging Het
Usp44 T C 10: 93,682,351 (GRCm39) V267A possibly damaging Het
Wac C A 18: 7,868,884 (GRCm39) probably null Het
Xkr5 T C 8: 18,983,569 (GRCm39) I658V probably benign Het
Zbtb38 A T 9: 96,568,707 (GRCm39) Y792* probably null Het
Other mutations in Bean1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02016:Bean1 APN 8 104,937,550 (GRCm39) missense possibly damaging 0.90
R0135:Bean1 UTSW 8 104,943,807 (GRCm39) missense probably damaging 1.00
R0490:Bean1 UTSW 8 104,941,660 (GRCm39) missense possibly damaging 0.76
R1319:Bean1 UTSW 8 104,943,856 (GRCm39) missense probably benign
R1920:Bean1 UTSW 8 104,937,742 (GRCm39) missense possibly damaging 0.92
R2513:Bean1 UTSW 8 104,908,643 (GRCm39) missense probably benign 0.04
R3980:Bean1 UTSW 8 104,937,730 (GRCm39) missense possibly damaging 0.92
R4209:Bean1 UTSW 8 104,940,566 (GRCm39) start codon destroyed probably null 0.04
R4369:Bean1 UTSW 8 104,943,742 (GRCm39) missense probably damaging 1.00
R4516:Bean1 UTSW 8 104,941,786 (GRCm39) missense probably damaging 1.00
R4542:Bean1 UTSW 8 104,937,591 (GRCm39) missense probably damaging 1.00
R4663:Bean1 UTSW 8 104,937,799 (GRCm39) missense probably damaging 1.00
R4962:Bean1 UTSW 8 104,943,606 (GRCm39) missense probably damaging 1.00
R5221:Bean1 UTSW 8 104,941,784 (GRCm39) missense probably damaging 1.00
R6288:Bean1 UTSW 8 104,937,622 (GRCm39) missense probably damaging 1.00
R6588:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R6994:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R7359:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R7451:Bean1 UTSW 8 104,940,628 (GRCm39) missense probably benign 0.01
R7454:Bean1 UTSW 8 104,937,658 (GRCm39) missense probably damaging 1.00
R7473:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R7537:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R7826:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8034:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8418:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8789:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8885:Bean1 UTSW 8 104,908,752 (GRCm39) critical splice donor site probably null
R8888:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8892:Bean1 UTSW 8 104,943,610 (GRCm39) missense probably damaging 1.00
R8896:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8992:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9015:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9113:Bean1 UTSW 8 104,940,557 (GRCm39) missense probably benign 0.00
R9122:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9135:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9151:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9255:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9340:Bean1 UTSW 8 104,908,739 (GRCm39) missense probably damaging 0.99
R9363:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9417:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9537:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9566:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9731:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
RF054:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACTGTGACCTCAATACCCCATG -3'
(R):5'- TCCACACTAGCCTTGGTCAG -3'

Sequencing Primer
(F):5'- GACCTCAATACCCCATGTGATATTC -3'
(R):5'- CTTGGTCAGGCTCAGTGC -3'
Posted On 2018-06-22