Incidental Mutation 'R6508:Rcc1l'
ID523984
Institutional Source Beutler Lab
Gene Symbol Rcc1l
Ensembl Gene ENSMUSG00000061979
Gene Namereculator of chromosome condensation 1 like
SynonymsWbscr16, 5730496C04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.566) question?
Stock #R6508 (G1)
Quality Score132.008
Status Not validated
Chromosome5
Chromosomal Location134148054-134176774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 134169238 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 185 (V185D)
Ref Sequence ENSEMBL: ENSMUSP00000075581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076228]
Predicted Effect probably damaging
Transcript: ENSMUST00000076228
AA Change: V185D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075581
Gene: ENSMUSG00000061979
AA Change: V185D

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 28 40 N/A INTRINSIC
low complexity region 70 92 N/A INTRINSIC
Pfam:RCC1 127 186 2.3e-10 PFAM
Pfam:RCC1_2 173 202 1e-9 PFAM
Pfam:RCC1 190 242 5.6e-11 PFAM
Pfam:RCC1_2 229 258 2.9e-12 PFAM
Pfam:RCC1 245 295 5.1e-8 PFAM
Pfam:RCC1 298 348 2e-12 PFAM
Pfam:RCC1_2 391 422 2.6e-9 PFAM
Pfam:RCC1 409 456 3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156574
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing regulator of chromosome condensation 1-like repeats. The encoded protein may function as a guanine nucleotide exchange factor. This gene is located in a region of chromosome 7 that is deleted in Williams-Beuren syndrome, a multisystem developmental disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 A T 5: 150,536,593 E444D possibly damaging Het
C87977 A T 4: 144,207,601 L312* probably null Het
Camkk2 G T 5: 122,746,319 N346K probably damaging Het
Car4 C A 11: 84,965,643 D252E possibly damaging Het
Chd1 A G 17: 15,738,633 K649R probably benign Het
Col12a1 A G 9: 79,649,949 Y1966H probably damaging Het
Cts6 T A 13: 61,196,407 H277L probably damaging Het
Dcc G T 18: 71,306,073 P1246Q probably damaging Het
Dlg5 G A 14: 24,138,706 T1739I probably benign Het
Eci1 T A 17: 24,437,309 N164K probably damaging Het
Entpd7 G A 19: 43,691,086 R26H probably damaging Het
Fanci A G 7: 79,443,768 K1008E probably damaging Het
Gm13124 G A 4: 144,565,020 R39* probably null Het
Htr2b T C 1: 86,102,464 T170A possibly damaging Het
Irgm2 A G 11: 58,219,501 E18G probably benign Het
Ispd C T 12: 36,426,299 A180V possibly damaging Het
Kdm1a A T 4: 136,554,310 V630E probably damaging Het
Keap1 G A 9: 21,231,714 T501I possibly damaging Het
L3mbtl3 T A 10: 26,318,427 H424L unknown Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Macf1 T A 4: 123,469,742 D3364V probably damaging Het
Map3k20 G A 2: 72,441,909 G794S probably benign Het
Mcat T C 15: 83,549,251 Q34R probably benign Het
Mettl4 T C 17: 94,743,945 E148G probably damaging Het
Mgat3 T C 15: 80,212,024 S351P possibly damaging Het
Mllt1 A T 17: 56,927,054 I44N probably damaging Het
Mlxipl G T 5: 135,128,620 A337S probably benign Het
Naip1 A G 13: 100,436,465 F254L probably damaging Het
Obscn A T 11: 59,054,147 probably null Het
Olfr1494 C T 19: 13,749,354 P83S probably damaging Het
Pcdh12 G A 18: 38,281,337 R912* probably null Het
Pcdh17 A G 14: 84,447,979 N629D probably damaging Het
Pcnx T C 12: 81,912,705 I170T probably damaging Het
Pgr A G 9: 8,956,289 Y746C probably damaging Het
Pum2 T C 12: 8,748,861 Y991H probably benign Het
Scarb1 A T 5: 125,304,325 S52T possibly damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Spata4 T C 8: 54,600,852 S18P probably benign Het
Stard13 G A 5: 151,063,289 T134I probably benign Het
Tbc1d32 C T 10: 56,224,690 C64Y probably damaging Het
Tll1 T G 8: 64,098,460 I296L probably damaging Het
Tmem229b T G 12: 78,964,906 T84P probably damaging Het
Ttn T C 2: 76,714,413 T32782A possibly damaging Het
Vmn1r73 G A 7: 11,756,704 V150I possibly damaging Het
Vmn2r80 T A 10: 79,194,456 F705L probably benign Het
Other mutations in Rcc1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0563:Rcc1l UTSW 5 134176555 missense probably benign 0.16
R1834:Rcc1l UTSW 5 134163659 missense probably damaging 1.00
R2108:Rcc1l UTSW 5 134155790 missense probably benign 0.00
R2512:Rcc1l UTSW 5 134166669 missense probably damaging 0.98
R3705:Rcc1l UTSW 5 134154191 missense probably damaging 1.00
R4192:Rcc1l UTSW 5 134155809 missense probably benign
R4658:Rcc1l UTSW 5 134171890 missense probably damaging 1.00
R4791:Rcc1l UTSW 5 134163776 missense possibly damaging 0.89
R6076:Rcc1l UTSW 5 134169328 missense possibly damaging 0.90
R6291:Rcc1l UTSW 5 134166721 splice site probably null
R6799:Rcc1l UTSW 5 134176713 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- TGTATGTAATGCCGCCCTCTG -3'
(R):5'- TCTGTAAGAGCTGAGGTGCCTG -3'

Sequencing Primer
(F):5'- TCAGTCCGTGGGGAAACAC -3'
(R):5'- AGCTGAGGTGCCTGAACCAG -3'
Posted On2018-06-22