Incidental Mutation 'R6508:Mgat3'
ID524033
Institutional Source Beutler Lab
Gene Symbol Mgat3
Ensembl Gene ENSMUSG00000042428
Gene Namemannoside acetylglucosaminyltransferase 3
SynonymsGnT-III, 1110038J12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R6508 (G1)
Quality Score204.009
Status Not validated
Chromosome15
Chromosomal Location80173721-80215519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80212024 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 351 (S351P)
Ref Sequence ENSEMBL: ENSMUSP00000043077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044970]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044970
AA Change: S351P

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043077
Gene: ENSMUSG00000042428
AA Change: S351P

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 73 87 N/A INTRINSIC
Pfam:Glyco_transf_17 191 362 3.2e-28 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are believed to be over 100 different glycosyltransferases involved in the synthesis of protein-bound and lipid-bound oligosaccharides. The enzyme encoded by this gene transfers a GlcNAc residue to the beta-linked mannose of the trimannosyl core of N-linked oligosaccharides and produces a bisecting GlcNAc. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced DEN and PB-induced hepatic tumors and reduced hepatocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 A T 5: 150,536,593 E444D possibly damaging Het
C87977 A T 4: 144,207,601 L312* probably null Het
Camkk2 G T 5: 122,746,319 N346K probably damaging Het
Car4 C A 11: 84,965,643 D252E possibly damaging Het
Chd1 A G 17: 15,738,633 K649R probably benign Het
Col12a1 A G 9: 79,649,949 Y1966H probably damaging Het
Cts6 T A 13: 61,196,407 H277L probably damaging Het
Dcc G T 18: 71,306,073 P1246Q probably damaging Het
Dlg5 G A 14: 24,138,706 T1739I probably benign Het
Eci1 T A 17: 24,437,309 N164K probably damaging Het
Entpd7 G A 19: 43,691,086 R26H probably damaging Het
Fanci A G 7: 79,443,768 K1008E probably damaging Het
Gm13124 G A 4: 144,565,020 R39* probably null Het
Htr2b T C 1: 86,102,464 T170A possibly damaging Het
Irgm2 A G 11: 58,219,501 E18G probably benign Het
Ispd C T 12: 36,426,299 A180V possibly damaging Het
Kdm1a A T 4: 136,554,310 V630E probably damaging Het
Keap1 G A 9: 21,231,714 T501I possibly damaging Het
L3mbtl3 T A 10: 26,318,427 H424L unknown Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Macf1 T A 4: 123,469,742 D3364V probably damaging Het
Map3k20 G A 2: 72,441,909 G794S probably benign Het
Mcat T C 15: 83,549,251 Q34R probably benign Het
Mettl4 T C 17: 94,743,945 E148G probably damaging Het
Mllt1 A T 17: 56,927,054 I44N probably damaging Het
Mlxipl G T 5: 135,128,620 A337S probably benign Het
Naip1 A G 13: 100,436,465 F254L probably damaging Het
Obscn A T 11: 59,054,147 probably null Het
Olfr1494 C T 19: 13,749,354 P83S probably damaging Het
Pcdh12 G A 18: 38,281,337 R912* probably null Het
Pcdh17 A G 14: 84,447,979 N629D probably damaging Het
Pcnx T C 12: 81,912,705 I170T probably damaging Het
Pgr A G 9: 8,956,289 Y746C probably damaging Het
Pum2 T C 12: 8,748,861 Y991H probably benign Het
Rcc1l A T 5: 134,169,238 V185D probably damaging Het
Scarb1 A T 5: 125,304,325 S52T possibly damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Spata4 T C 8: 54,600,852 S18P probably benign Het
Stard13 G A 5: 151,063,289 T134I probably benign Het
Tbc1d32 C T 10: 56,224,690 C64Y probably damaging Het
Tll1 T G 8: 64,098,460 I296L probably damaging Het
Tmem229b T G 12: 78,964,906 T84P probably damaging Het
Ttn T C 2: 76,714,413 T32782A possibly damaging Het
Vmn1r73 G A 7: 11,756,704 V150I possibly damaging Het
Vmn2r80 T A 10: 79,194,456 F705L probably benign Het
Other mutations in Mgat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Mgat3 APN 15 80212433 missense probably damaging 1.00
IGL01134:Mgat3 APN 15 80212176 missense probably benign 0.17
R0077:Mgat3 UTSW 15 80212577 missense probably benign 0.00
R1171:Mgat3 UTSW 15 80211637 missense probably benign 0.26
R1885:Mgat3 UTSW 15 80211619 missense probably benign 0.25
R1886:Mgat3 UTSW 15 80211619 missense probably benign 0.25
R1986:Mgat3 UTSW 15 80212189 missense probably benign 0.04
R2125:Mgat3 UTSW 15 80211886 missense probably benign 0.00
R3081:Mgat3 UTSW 15 80211854 missense probably benign 0.33
R4819:Mgat3 UTSW 15 80212349 missense probably damaging 1.00
R4992:Mgat3 UTSW 15 80212542 missense probably benign
R5083:Mgat3 UTSW 15 80211298 missense possibly damaging 0.92
R5356:Mgat3 UTSW 15 80211610 missense possibly damaging 0.88
R5356:Mgat3 UTSW 15 80212454 missense probably damaging 1.00
R6784:Mgat3 UTSW 15 80212200 missense probably damaging 0.98
R7021:Mgat3 UTSW 15 80212454 missense probably damaging 1.00
R7056:Mgat3 UTSW 15 80211896 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTGCGGATGACTACCTGCG -3'
(R):5'- TGAAGCACCAGGAGCAATGC -3'

Sequencing Primer
(F):5'- GATGACTACCTGCGCACCTTC -3'
(R):5'- GACCACTGCACTAGGATGTG -3'
Posted On2018-06-22