Incidental Mutation 'R6616:Hpd'
ID524048
Institutional Source Beutler Lab
Gene Symbol Hpd
Ensembl Gene ENSMUSG00000029445
Gene Name4-hydroxyphenylpyruvic acid dioxygenase
SynonymsLaf, Flp, Fla, Hppd
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R6616 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location123171807-123182727 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123172060 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 367 (L367Q)
Ref Sequence ENSEMBL: ENSMUSP00000031398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031398] [ENSMUST00000056053] [ENSMUST00000163030] [ENSMUST00000174836]
Predicted Effect probably damaging
Transcript: ENSMUST00000031398
AA Change: L367Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031398
Gene: ENSMUSG00000029445
AA Change: L367Q

DomainStartEndE-ValueType
Pfam:Glyoxalase 18 138 5.6e-10 PFAM
Pfam:Glyoxalase_4 20 134 7.7e-10 PFAM
Pfam:Glyoxalase_2 24 147 4.5e-9 PFAM
Pfam:Glyoxalase 180 335 2.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056053
SMART Domains Protein: ENSMUSP00000134686
Gene: ENSMUSG00000038384

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
RRM 103 176 6.41e-13 SMART
low complexity region 229 241 N/A INTRINSIC
internal_repeat_1 248 266 1.29e-7 PROSPERO
internal_repeat_1 279 296 1.29e-7 PROSPERO
low complexity region 366 381 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
low complexity region 422 448 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 565 599 N/A INTRINSIC
low complexity region 650 746 N/A INTRINSIC
Blast:SET 749 976 5e-26 BLAST
low complexity region 979 992 N/A INTRINSIC
coiled coil region 1053 1088 N/A INTRINSIC
low complexity region 1136 1147 N/A INTRINSIC
coiled coil region 1190 1213 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1281 1292 N/A INTRINSIC
low complexity region 1322 1383 N/A INTRINSIC
low complexity region 1402 1442 N/A INTRINSIC
low complexity region 1484 1548 N/A INTRINSIC
low complexity region 1600 1618 N/A INTRINSIC
N-SET 1692 1836 1.54e-67 SMART
SET 1846 1969 4.03e-36 SMART
PostSET 1969 1985 4.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144679
SMART Domains Protein: ENSMUSP00000118702
Gene: ENSMUSG00000029445

DomainStartEndE-ValueType
PDB:1SQI|B 2 89 4e-51 PDB
SCOP:d1cjxa2 3 89 3e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155092
Predicted Effect probably benign
Transcript: ENSMUST00000163030
SMART Domains Protein: ENSMUSP00000133933
Gene: ENSMUSG00000038384

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
RRM 103 176 6.41e-13 SMART
low complexity region 229 241 N/A INTRINSIC
internal_repeat_1 248 266 1.29e-7 PROSPERO
internal_repeat_1 279 296 1.29e-7 PROSPERO
low complexity region 366 381 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
low complexity region 422 448 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 565 599 N/A INTRINSIC
low complexity region 650 746 N/A INTRINSIC
Blast:SET 749 976 5e-26 BLAST
low complexity region 979 992 N/A INTRINSIC
coiled coil region 1053 1088 N/A INTRINSIC
low complexity region 1136 1147 N/A INTRINSIC
coiled coil region 1190 1213 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1281 1292 N/A INTRINSIC
low complexity region 1322 1383 N/A INTRINSIC
low complexity region 1402 1442 N/A INTRINSIC
low complexity region 1484 1548 N/A INTRINSIC
low complexity region 1600 1618 N/A INTRINSIC
N-SET 1692 1836 1.54e-67 SMART
SET 1846 1969 4.03e-36 SMART
PostSET 1969 1985 4.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174836
SMART Domains Protein: ENSMUSP00000134461
Gene: ENSMUSG00000038384

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
RRM 103 176 6.41e-13 SMART
low complexity region 229 241 N/A INTRINSIC
internal_repeat_1 248 266 1.92e-7 PROSPERO
internal_repeat_1 279 296 1.92e-7 PROSPERO
low complexity region 366 381 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
low complexity region 422 448 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 565 599 N/A INTRINSIC
low complexity region 650 746 N/A INTRINSIC
Blast:SET 749 976 5e-26 BLAST
low complexity region 979 992 N/A INTRINSIC
coiled coil region 1053 1088 N/A INTRINSIC
coiled coil region 1149 1172 N/A INTRINSIC
low complexity region 1208 1221 N/A INTRINSIC
low complexity region 1240 1251 N/A INTRINSIC
low complexity region 1281 1342 N/A INTRINSIC
low complexity region 1361 1401 N/A INTRINSIC
low complexity region 1443 1507 N/A INTRINSIC
low complexity region 1559 1577 N/A INTRINSIC
N-SET 1651 1795 1.54e-67 SMART
SET 1805 1928 4.03e-36 SMART
PostSET 1928 1944 4.8e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199260
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme in the catabolic pathway of tyrosine. The encoded protein catalyzes the conversion of 4-hydroxyphenylpyruvate to homogentisate. Defects in this gene are a cause of tyrosinemia type 3 (TYRO3) and hawkinsinuria (HAWK). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
PHENOTYPE: CBA, C3H, DBA/2, SM and AKR have the F.1 form of this soluble liver antigen; A/J, A2G, BALB/c and C57BL/10 the F.2 form. F.2 antigen induces precipitating antibodies in F.1 but not F.2 strains and vice versa. F antigen immune response requires H2 Kk or Ak alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,384,535 H567L probably damaging Het
Adck1 T A 12: 88,461,188 M525K unknown Het
Alpi T C 1: 87,101,114 I74V possibly damaging Het
Creb5 A C 6: 53,685,310 Q197H possibly damaging Het
Cyp2b13 A G 7: 26,085,881 K225R probably benign Het
Dock1 G A 7: 135,108,492 E1143K possibly damaging Het
Eef2kmt T A 16: 5,247,482 D287V probably damaging Het
Eif2ak4 T A 2: 118,454,845 Y1046* probably null Het
Fbxw10 T A 11: 62,853,024 M252K probably benign Het
Fnip2 A C 3: 79,480,882 H847Q probably benign Het
Frmd3 A T 4: 74,187,488 D457V probably damaging Het
Gm13941 T G 2: 111,101,175 E37D unknown Het
Gm8251 C A 1: 44,061,474 V155L possibly damaging Het
Grin1 T A 2: 25,292,110 I870F possibly damaging Het
Grin2b A C 6: 135,732,551 D1332E probably benign Het
Gtpbp4 G A 13: 8,989,105 T201I possibly damaging Het
Heatr4 A G 12: 83,980,130 C118R probably benign Het
Hltf T A 3: 20,109,487 probably null Het
Hmcn1 C T 1: 150,723,257 probably null Het
Htr1b A G 9: 81,632,434 I40T probably benign Het
Il16 A G 7: 83,646,476 S464P probably benign Het
Lrp1b T A 2: 40,699,631 D75V unknown Het
Map3k4 A T 17: 12,271,344 L400Q probably damaging Het
Mcts2 T A 2: 152,687,662 I131N possibly damaging Het
Mroh2b A C 15: 4,953,282 I1528L probably benign Het
Muc4 A C 16: 32,782,008 D3467A possibly damaging Het
Mypn A T 10: 63,169,312 C339S probably damaging Het
Ncoa5 A T 2: 165,010,563 Y130* probably null Het
Olfr1381 T A 11: 49,552,041 V98E probably damaging Het
Olfr743 T A 14: 50,533,907 I165N probably benign Het
Pcdha4 A G 18: 36,953,900 T379A probably benign Het
Pkp4 C G 2: 59,350,552 Y720* probably null Het
Prl5a1 C T 13: 28,149,856 T114I probably benign Het
Rnd3 A G 2: 51,134,157 S137P probably damaging Het
Rtel1 G A 2: 181,352,786 E680K possibly damaging Het
Sbsn T A 7: 30,753,279 V573D possibly damaging Het
Scaf8 A T 17: 3,168,055 L233F unknown Het
Sec23a A T 12: 58,997,155 I241K possibly damaging Het
Secisbp2l A T 2: 125,768,226 S258T probably damaging Het
Skint4 A G 4: 112,118,230 H121R possibly damaging Het
Sptbn1 T A 11: 30,124,030 E1346D probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stpg4 A G 17: 87,422,696 Y74H probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmc4 A G 7: 3,671,058 V374A possibly damaging Het
Unc45b G A 11: 82,911,819 R47Q probably damaging Het
Xirp1 A G 9: 120,019,014 S268P probably damaging Het
Zfp990 A T 4: 145,537,145 I238L probably benign Het
Zswim5 A G 4: 116,986,741 D992G possibly damaging Het
Other mutations in Hpd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02483:Hpd APN 5 123182578 splice site probably null
IGL02510:Hpd APN 5 123181910 missense possibly damaging 0.95
IGL02574:Hpd APN 5 123179357 splice site probably benign
IGL02642:Hpd APN 5 123181440 missense possibly damaging 0.86
IGL03374:Hpd APN 5 123172045 missense probably damaging 1.00
R0079:Hpd UTSW 5 123181481 missense probably damaging 1.00
R1022:Hpd UTSW 5 123174469 missense possibly damaging 0.94
R1024:Hpd UTSW 5 123174469 missense possibly damaging 0.94
R1165:Hpd UTSW 5 123176090 critical splice donor site probably null
R2414:Hpd UTSW 5 123177524 unclassified probably null
R6572:Hpd UTSW 5 123180676 missense probably benign 0.22
R6604:Hpd UTSW 5 123180901 unclassified probably null
X0023:Hpd UTSW 5 123174439 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCGGACTCTTGTAATAGAGGG -3'
(R):5'- CGAGAAAGGCTACCTCCTACAG -3'

Sequencing Primer
(F):5'- ACTCTTGTAATAGAGGGGGCGTG -3'
(R):5'- GAAAGGCTACCTCCTACAGATCTTC -3'
Posted On2018-06-22