Incidental Mutation 'R6508:Olfr1494'
ID524051
Institutional Source Beutler Lab
Gene Symbol Olfr1494
Ensembl Gene ENSMUSG00000050865
Gene Nameolfactory receptor 1494
SynonymsMOR266-1, GA_x6K02T2RE5P-4082427-4083374
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6508 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location13739728-13750479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 13749354 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 83 (P83S)
Ref Sequence ENSEMBL: ENSMUSP00000146563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051768] [ENSMUST00000207836]
Predicted Effect probably damaging
Transcript: ENSMUST00000051768
AA Change: P83S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056291
Gene: ENSMUSG00000050865
AA Change: P83S

DomainStartEndE-ValueType
low complexity region 13 27 N/A INTRINSIC
Pfam:7tm_4 35 313 3.2e-53 PFAM
Pfam:7tm_1 45 295 7.5e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207836
AA Change: P83S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214697
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 A T 5: 150,536,593 E444D possibly damaging Het
C87977 A T 4: 144,207,601 L312* probably null Het
Camkk2 G T 5: 122,746,319 N346K probably damaging Het
Car4 C A 11: 84,965,643 D252E possibly damaging Het
Chd1 A G 17: 15,738,633 K649R probably benign Het
Col12a1 A G 9: 79,649,949 Y1966H probably damaging Het
Cts6 T A 13: 61,196,407 H277L probably damaging Het
Dcc G T 18: 71,306,073 P1246Q probably damaging Het
Dlg5 G A 14: 24,138,706 T1739I probably benign Het
Eci1 T A 17: 24,437,309 N164K probably damaging Het
Entpd7 G A 19: 43,691,086 R26H probably damaging Het
Fanci A G 7: 79,443,768 K1008E probably damaging Het
Gm13124 G A 4: 144,565,020 R39* probably null Het
Htr2b T C 1: 86,102,464 T170A possibly damaging Het
Irgm2 A G 11: 58,219,501 E18G probably benign Het
Ispd C T 12: 36,426,299 A180V possibly damaging Het
Kdm1a A T 4: 136,554,310 V630E probably damaging Het
Keap1 G A 9: 21,231,714 T501I possibly damaging Het
L3mbtl3 T A 10: 26,318,427 H424L unknown Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Macf1 T A 4: 123,469,742 D3364V probably damaging Het
Map3k20 G A 2: 72,441,909 G794S probably benign Het
Mcat T C 15: 83,549,251 Q34R probably benign Het
Mettl4 T C 17: 94,743,945 E148G probably damaging Het
Mgat3 T C 15: 80,212,024 S351P possibly damaging Het
Mllt1 A T 17: 56,927,054 I44N probably damaging Het
Mlxipl G T 5: 135,128,620 A337S probably benign Het
Naip1 A G 13: 100,436,465 F254L probably damaging Het
Obscn A T 11: 59,054,147 probably null Het
Pcdh12 G A 18: 38,281,337 R912* probably null Het
Pcdh17 A G 14: 84,447,979 N629D probably damaging Het
Pcnx T C 12: 81,912,705 I170T probably damaging Het
Pgr A G 9: 8,956,289 Y746C probably damaging Het
Pum2 T C 12: 8,748,861 Y991H probably benign Het
Rcc1l A T 5: 134,169,238 V185D probably damaging Het
Scarb1 A T 5: 125,304,325 S52T possibly damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Spata4 T C 8: 54,600,852 S18P probably benign Het
Stard13 G A 5: 151,063,289 T134I probably benign Het
Tbc1d32 C T 10: 56,224,690 C64Y probably damaging Het
Tll1 T G 8: 64,098,460 I296L probably damaging Het
Tmem229b T G 12: 78,964,906 T84P probably damaging Het
Ttn T C 2: 76,714,413 T32782A possibly damaging Het
Vmn1r73 G A 7: 11,756,704 V150I possibly damaging Het
Vmn2r80 T A 10: 79,194,456 F705L probably benign Het
Other mutations in Olfr1494
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02134:Olfr1494 APN 19 13749801 missense probably benign 0.04
IGL02335:Olfr1494 APN 19 13749934 missense probably benign 0.01
IGL02388:Olfr1494 APN 19 13749630 missense possibly damaging 0.91
IGL03231:Olfr1494 APN 19 13749385 missense probably benign 0.35
R0133:Olfr1494 UTSW 19 13749988 missense probably damaging 1.00
R0142:Olfr1494 UTSW 19 13749255 missense probably benign 0.00
R0561:Olfr1494 UTSW 19 13749298 missense probably damaging 1.00
R0783:Olfr1494 UTSW 19 13749676 missense probably damaging 0.99
R1826:Olfr1494 UTSW 19 13749347 missense probably benign 0.05
R1967:Olfr1494 UTSW 19 13750053 makesense probably null
R3706:Olfr1494 UTSW 19 13749112 missense probably benign 0.42
R5417:Olfr1494 UTSW 19 13749853 missense probably benign 0.18
R7126:Olfr1494 UTSW 19 13749523 missense possibly damaging 0.90
R7262:Olfr1494 UTSW 19 13749171 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACCACTGAGTTTGTGTTCCG -3'
(R):5'- TCTGGACACACAGCTTCTTGG -3'

Sequencing Primer
(F):5'- ACCACTGTCCCTGAATTCCAG -3'
(R):5'- CACACAGCTTCTTGGTCATGATGAG -3'
Posted On2018-06-22