Incidental Mutation 'R6580:Ptdss2'
ID524082
Institutional Source Beutler Lab
Gene Symbol Ptdss2
Ensembl Gene ENSMUSG00000025495
Gene Namephosphatidylserine synthase 2
SynonymsPSS2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R6580 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location141122382-141157606 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141153012 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 236 (I236N)
Ref Sequence ENSEMBL: ENSMUSP00000026568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026568] [ENSMUST00000172479] [ENSMUST00000172787] [ENSMUST00000209928]
Predicted Effect probably damaging
Transcript: ENSMUST00000026568
AA Change: I236N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026568
Gene: ENSMUSG00000025495
AA Change: I236N

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
transmembrane domain 73 90 N/A INTRINSIC
Pfam:PSS 98 378 1.8e-113 PFAM
transmembrane domain 388 410 N/A INTRINSIC
low complexity region 438 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172479
Predicted Effect probably benign
Transcript: ENSMUST00000172787
SMART Domains Protein: ENSMUSP00000133352
Gene: ENSMUSG00000025495

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 35 52 N/A INTRINSIC
Pfam:PSS 60 191 7.3e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174706
Predicted Effect probably benign
Transcript: ENSMUST00000209928
Meta Mutation Damage Score 0.418 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the conversion of phosphatidylethanolamine to phosphatidylserine, a structural membrane phospholipid that functions in cell signaling, blood coagulation, and apoptosis. The encoded enzyme also has a high affinity for docosahexaenoic acid (DHA) and can use it to make DHA-containing phosphatidylserine. [provided by RefSeq, Jul 2016]
PHENOTYPE: Disruption of this gene causes infertility in about 10% of homozygous males. The remaining males and all females were fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,066,625 R525H probably benign Het
1700007K13Rik A G 2: 28,466,050 W74R probably damaging Het
Acox3 T A 5: 35,608,403 L600Q probably damaging Het
Ankrd49 A G 9: 14,781,398 S157P probably damaging Het
Ccdc141 A G 2: 77,011,755 F1444S possibly damaging Het
Defb28 C T 2: 152,518,295 S10L possibly damaging Het
Epha6 T G 16: 59,682,616 N976T probably damaging Het
Gm45861 A G 8: 27,544,951 K976E unknown Het
Gtf2ird1 T G 5: 134,361,039 N920H probably damaging Het
Gtf3c1 A T 7: 125,644,347 M1695K probably benign Het
Hfm1 C T 5: 106,847,709 E1279K probably benign Het
Il31ra C T 13: 112,551,942 D34N possibly damaging Het
Klhl3 T A 13: 58,018,887 I430F possibly damaging Het
Lexm G T 4: 106,611,514 H271N possibly damaging Het
Mfhas1 A G 8: 35,589,265 Y298C probably damaging Het
Muc20 A T 16: 32,793,489 M506K possibly damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Naip1 T A 13: 100,444,649 D30V probably damaging Het
Nol9 A G 4: 152,051,761 N430S probably benign Het
Olfr907 T C 9: 38,499,023 M118T probably damaging Het
Palm3 A G 8: 84,029,548 E563G probably damaging Het
Pcdhga4 A G 18: 37,687,317 S640G possibly damaging Het
Pi4ka A G 16: 17,350,830 F679L probably damaging Het
Polr3c A G 3: 96,727,343 probably null Het
Rapgef1 A G 2: 29,730,609 Y879C possibly damaging Het
Shc3 T C 13: 51,442,773 T405A probably benign Het
Smtnl2 G T 11: 72,403,033 S232R probably benign Het
Taar8a G A 10: 24,076,893 A132T probably damaging Het
Tex47 T C 5: 7,305,212 I131T probably damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vmn1r63 A G 7: 5,802,914 S240P probably benign Het
Vmn2r84 A G 10: 130,389,241 W467R possibly damaging Het
Vmn2r-ps130 T C 17: 23,063,766 V140A probably benign Het
Zscan12 T C 13: 21,369,158 L384P probably damaging Het
Other mutations in Ptdss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Ptdss2 APN 7 141143125 missense probably benign 0.35
IGL01860:Ptdss2 APN 7 141152836 missense probably damaging 1.00
IGL01966:Ptdss2 APN 7 141135391 missense possibly damaging 0.66
IGL02606:Ptdss2 APN 7 141152998 nonsense probably null
R0105:Ptdss2 UTSW 7 141152880 missense probably damaging 1.00
R0138:Ptdss2 UTSW 7 141155319 splice site probably benign
R0503:Ptdss2 UTSW 7 141151797 unclassified probably benign
R2397:Ptdss2 UTSW 7 141147092 missense probably benign 0.02
R3120:Ptdss2 UTSW 7 141152219 missense probably damaging 1.00
R4519:Ptdss2 UTSW 7 141154578 missense probably benign 0.30
R4728:Ptdss2 UTSW 7 141154459 missense probably benign 0.30
R5158:Ptdss2 UTSW 7 141151771 missense probably benign 0.16
R6186:Ptdss2 UTSW 7 141154949 unclassified probably benign
R6464:Ptdss2 UTSW 7 141152211 missense probably damaging 1.00
R7290:Ptdss2 UTSW 7 141151780 missense possibly damaging 0.58
R7307:Ptdss2 UTSW 7 141151732 missense possibly damaging 0.51
R7444:Ptdss2 UTSW 7 141153084 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGTTCCTGGAGTACAGCCTG -3'
(R):5'- CCTCTTGAGAGAAGCAAGCC -3'

Sequencing Primer
(F):5'- CCCAACTTCAGCGAGTG -3'
(R):5'- CCAGATGGAGGACTAGCAGTCAC -3'
Posted On2018-06-22