Incidental Mutation 'R6616:Abca3'
ID524101
Institutional Source Beutler Lab
Gene Symbol Abca3
Ensembl Gene ENSMUSG00000024130
Gene NameATP-binding cassette, sub-family A (ABC1), member 3
SynonymsABC-C, 1810036E22Rik, Abc3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6616 (G1)
Quality Score210.009
Status Validated
Chromosome17
Chromosomal Location24351950-24410201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24384535 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 567 (H567L)
Ref Sequence ENSEMBL: ENSMUSP00000078544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039013] [ENSMUST00000079594] [ENSMUST00000117337]
Predicted Effect probably damaging
Transcript: ENSMUST00000039013
AA Change: H567L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045285
Gene: ENSMUSG00000024130
AA Change: H567L

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 21 469 2.1e-29 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 923 1323 1.8e-35 PFAM
AAA 1408 1592 1.64e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079594
AA Change: H567L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078544
Gene: ENSMUSG00000024130
AA Change: H567L

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 22 469 2.6e-28 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 923 1323 5.5e-39 PFAM
AAA 1408 1592 1.64e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000117337
AA Change: H567L
SMART Domains Protein: ENSMUSP00000113538
Gene: ENSMUSG00000024130
AA Change: H567L

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 21 469 1.3e-29 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 761 1068 8.8e-29 PFAM
AAA 1153 1337 1.64e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148557
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The full transporter encoded by this gene may be involved in development of resistance to xenobiotics and engulfment during programmed cell death. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display neonatal lethality, respiratory failure, and severely impaired surfactant secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 T A 12: 88,461,188 M525K unknown Het
Alpi T C 1: 87,101,114 I74V possibly damaging Het
Creb5 A C 6: 53,685,310 Q197H possibly damaging Het
Cyp2b13 A G 7: 26,085,881 K225R probably benign Het
Dock1 G A 7: 135,108,492 E1143K possibly damaging Het
Eef2kmt T A 16: 5,247,482 D287V probably damaging Het
Eif2ak4 T A 2: 118,454,845 Y1046* probably null Het
Fbxw10 T A 11: 62,853,024 M252K probably benign Het
Fnip2 A C 3: 79,480,882 H847Q probably benign Het
Frmd3 A T 4: 74,187,488 D457V probably damaging Het
Gm13941 T G 2: 111,101,175 E37D unknown Het
Gm8251 C A 1: 44,061,474 V155L possibly damaging Het
Grin1 T A 2: 25,292,110 I870F possibly damaging Het
Grin2b A C 6: 135,732,551 D1332E probably benign Het
Gtpbp4 G A 13: 8,989,105 T201I possibly damaging Het
Heatr4 A G 12: 83,980,130 C118R probably benign Het
Hltf T A 3: 20,109,487 probably null Het
Hmcn1 C T 1: 150,723,257 probably null Het
Hpd A T 5: 123,172,060 L367Q probably damaging Het
Htr1b A G 9: 81,632,434 I40T probably benign Het
Il16 A G 7: 83,646,476 S464P probably benign Het
Lrp1b T A 2: 40,699,631 D75V unknown Het
Map3k4 A T 17: 12,271,344 L400Q probably damaging Het
Mcts2 T A 2: 152,687,662 I131N possibly damaging Het
Mroh2b A C 15: 4,953,282 I1528L probably benign Het
Muc4 A C 16: 32,782,008 D3467A possibly damaging Het
Mypn A T 10: 63,169,312 C339S probably damaging Het
Ncoa5 A T 2: 165,010,563 Y130* probably null Het
Olfr1381 T A 11: 49,552,041 V98E probably damaging Het
Olfr743 T A 14: 50,533,907 I165N probably benign Het
Pcdha4 A G 18: 36,953,900 T379A probably benign Het
Pkp4 C G 2: 59,350,552 Y720* probably null Het
Prl5a1 C T 13: 28,149,856 T114I probably benign Het
Rnd3 A G 2: 51,134,157 S137P probably damaging Het
Rtel1 G A 2: 181,352,786 E680K possibly damaging Het
Sbsn T A 7: 30,753,279 V573D possibly damaging Het
Scaf8 A T 17: 3,168,055 L233F unknown Het
Sec23a A T 12: 58,997,155 I241K possibly damaging Het
Secisbp2l A T 2: 125,768,226 S258T probably damaging Het
Skint4 A G 4: 112,118,230 H121R possibly damaging Het
Sptbn1 T A 11: 30,124,030 E1346D probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stpg4 A G 17: 87,422,696 Y74H probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmc4 A G 7: 3,671,058 V374A possibly damaging Het
Unc45b G A 11: 82,911,819 R47Q probably damaging Het
Xirp1 A G 9: 120,019,014 S268P probably damaging Het
Zfp990 A T 4: 145,537,145 I238L probably benign Het
Zswim5 A G 4: 116,986,741 D992G possibly damaging Het
Other mutations in Abca3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Abca3 APN 17 24374246 missense probably damaging 1.00
IGL01538:Abca3 APN 17 24376473 missense possibly damaging 0.64
IGL01633:Abca3 APN 17 24397353 nonsense probably null
IGL01837:Abca3 APN 17 24408697 missense probably damaging 1.00
IGL01986:Abca3 APN 17 24408114 missense probably damaging 1.00
IGL02049:Abca3 APN 17 24376730 nonsense probably null
IGL02186:Abca3 APN 17 24377740 missense possibly damaging 0.95
IGL02794:Abca3 APN 17 24402411 missense probably benign 0.05
IGL02962:Abca3 APN 17 24400409 missense probably damaging 1.00
IGL02963:Abca3 APN 17 24384529 missense probably damaging 1.00
IGL03118:Abca3 APN 17 24400450 missense probably benign 0.17
IGL03144:Abca3 APN 17 24381964 missense probably benign 0.37
R0028:Abca3 UTSW 17 24377724 missense probably benign 0.39
R0278:Abca3 UTSW 17 24381920 missense probably benign 0.09
R0570:Abca3 UTSW 17 24374399 missense probably benign
R0825:Abca3 UTSW 17 24400577 missense probably damaging 1.00
R1164:Abca3 UTSW 17 24402331 missense probably damaging 1.00
R1348:Abca3 UTSW 17 24374238 splice site probably null
R1557:Abca3 UTSW 17 24399980 missense possibly damaging 0.46
R1661:Abca3 UTSW 17 24377842 missense probably damaging 0.99
R1665:Abca3 UTSW 17 24377842 missense probably damaging 0.99
R1754:Abca3 UTSW 17 24377779 missense probably benign 0.00
R1828:Abca3 UTSW 17 24366197 missense probably benign 0.34
R1834:Abca3 UTSW 17 24376692 missense probably benign 0.00
R1996:Abca3 UTSW 17 24387532 missense probably damaging 1.00
R2032:Abca3 UTSW 17 24366082 splice site probably benign
R2100:Abca3 UTSW 17 24408209 missense probably damaging 0.99
R2154:Abca3 UTSW 17 24377719 missense probably damaging 1.00
R2240:Abca3 UTSW 17 24376443 missense probably damaging 0.98
R2281:Abca3 UTSW 17 24376726 missense possibly damaging 0.88
R2994:Abca3 UTSW 17 24384564 missense probably damaging 1.00
R4091:Abca3 UTSW 17 24397482 missense probably damaging 1.00
R4294:Abca3 UTSW 17 24400569 missense possibly damaging 0.96
R4496:Abca3 UTSW 17 24383973 missense possibly damaging 0.93
R4633:Abca3 UTSW 17 24387529 missense probably null 1.00
R4866:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5022:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5023:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5072:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5073:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5074:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5123:Abca3 UTSW 17 24384460 missense possibly damaging 0.95
R5157:Abca3 UTSW 17 24408122 missense probably damaging 1.00
R5183:Abca3 UTSW 17 24374453 missense probably benign 0.39
R5269:Abca3 UTSW 17 24376743 missense possibly damaging 0.95
R5566:Abca3 UTSW 17 24383927 missense probably benign
R5579:Abca3 UTSW 17 24376729 missense probably damaging 0.97
R5620:Abca3 UTSW 17 24396470 missense probably benign 0.05
R5755:Abca3 UTSW 17 24398454 missense probably damaging 1.00
R5954:Abca3 UTSW 17 24397416 missense probably benign 0.00
R6041:Abca3 UTSW 17 24376380 missense probably damaging 0.99
R6187:Abca3 UTSW 17 24408167 missense possibly damaging 0.88
R6253:Abca3 UTSW 17 24397552 missense probably benign 0.01
R6375:Abca3 UTSW 17 24387562 missense possibly damaging 0.96
R6487:Abca3 UTSW 17 24397472 missense possibly damaging 0.81
R6632:Abca3 UTSW 17 24384470 missense probably benign
R6781:Abca3 UTSW 17 24374406 missense possibly damaging 0.95
R6918:Abca3 UTSW 17 24408658 missense probably damaging 1.00
R6962:Abca3 UTSW 17 24364726 missense probably benign 0.39
R7163:Abca3 UTSW 17 24364942 missense probably benign
R7199:Abca3 UTSW 17 24377707 missense probably damaging 1.00
R7287:Abca3 UTSW 17 24385887 missense possibly damaging 0.91
R7303:Abca3 UTSW 17 24398521 missense possibly damaging 0.83
X0018:Abca3 UTSW 17 24396480 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AGACGTTAGGGTCGTGTTCC -3'
(R):5'- CAGGTTTGAGCATTCATAGACAG -3'

Sequencing Primer
(F):5'- ACGTTAGGGTCGTGTTCCAAAGG -3'
(R):5'- TTTGAGCATTCATAGACAGAGGCTG -3'
Posted On2018-06-22