Incidental Mutation 'R6617:Vcam1'
ID524124
Institutional Source Beutler Lab
Gene Symbol Vcam1
Ensembl Gene ENSMUSG00000027962
Gene Namevascular cell adhesion molecule 1
SynonymsVcam-1, CD106
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.483) question?
Stock #R6617 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location116109949-116129688 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116126062 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 185 (V185A)
Ref Sequence ENSEMBL: ENSMUSP00000029574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029574] [ENSMUST00000196309] [ENSMUST00000196449]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029574
AA Change: V185A

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029574
Gene: ENSMUSG00000027962
AA Change: V185A

DomainStartEndE-ValueType
IG 32 113 2.41e-6 SMART
Pfam:C2-set 133 221 4.5e-27 PFAM
IGc2 237 298 2.09e-15 SMART
IGc2 326 390 8.38e-6 SMART
Pfam:C2-set 421 509 7.2e-26 PFAM
IGc2 525 586 7.35e-11 SMART
IG 608 686 2.25e-6 SMART
transmembrane domain 699 721 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196309
AA Change: V191A

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000143260
Gene: ENSMUSG00000027962
AA Change: V191A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IG 38 119 1e-8 SMART
Pfam:C2-set 139 227 1.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196449
AA Change: V185A

PolyPhen 2 Score 0.449 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142876
Gene: ENSMUSG00000027962
AA Change: V185A

DomainStartEndE-ValueType
IG 32 113 2.41e-6 SMART
Pfam:C2-set 133 221 1.3e-27 PFAM
IGc2 237 298 2.09e-15 SMART
transmembrane domain 322 344 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198269
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Ig superfamily and encodes a cell surface sialoglycoprotein expressed by cytokine-activated endothelium. This type I membrane protein mediates leukocyte-endothelial cell adhesion and signal transduction, and may play a role in the development of artherosclerosis and rheumatoid arthritis. Three alternatively spliced transcripts encoding different isoforms have been described for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Most homozygous null mutants die by embryonic day 12.5 due to defective placenta and failure of chorion/allantois fusion, and heart developmental anomalies. Survivors are generally normal, but have high numbers of circulating blood mononuclear leukocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b T A 12: 113,490,532 I323K possibly damaging Het
Agbl4 T A 4: 110,580,135 V81D probably damaging Het
Akap13 A G 7: 75,730,363 D2147G possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Arhgef18 T C 8: 3,439,592 L308P probably damaging Het
Atad2b C A 12: 5,024,668 L1076I probably benign Het
Chp2 T C 7: 122,220,694 V59A probably benign Het
Cped1 T A 6: 22,215,547 C555* probably null Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Crispld1 G A 1: 17,728,662 M2I probably benign Het
Cul3 T C 1: 80,276,439 N540S probably damaging Het
Dll4 A G 2: 119,327,931 T134A probably benign Het
Fat2 G A 11: 55,296,105 T1305I probably benign Het
Fbxw8 A G 5: 118,142,666 probably null Het
Gm9195 A T 14: 72,431,775 L2649H probably damaging Het
Gprc5c A G 11: 114,864,105 I203V probably benign Het
Hmcn1 T C 1: 150,743,796 D1189G probably benign Het
Hnrnpl C A 7: 28,818,584 probably benign Het
Homer1 T A 13: 93,341,862 Y38N probably damaging Het
Itgb5 A G 16: 33,946,592 T707A probably benign Het
Lmbrd1 G A 1: 24,685,428 R31Q probably damaging Het
Mbtps1 G A 8: 119,538,137 P341S probably damaging Het
Mlxip A G 5: 123,442,449 probably null Het
Myh13 A T 11: 67,361,400 T1445S probably benign Het
Ncapg C T 5: 45,670,132 A37V probably benign Het
Neb A G 2: 52,207,747 F4909L probably damaging Het
Nrcam T A 12: 44,540,963 W141R probably damaging Het
Olfr424 T G 1: 174,137,248 F168C probably damaging Het
Phykpl A G 11: 51,593,954 E247G probably damaging Het
Plekhh2 A G 17: 84,566,287 I333M possibly damaging Het
Sorcs2 A G 5: 36,077,966 F69L probably damaging Het
Sspo C A 6: 48,491,046 T349K possibly damaging Het
Stap2 A G 17: 55,999,746 S276P probably benign Het
Tle1 A G 4: 72,141,280 S275P probably damaging Het
Topors G A 4: 40,261,896 Q463* probably null Het
Tsc1 A G 2: 28,686,989 D1101G possibly damaging Het
Tyrp1 G A 4: 80,846,747 A54T probably benign Het
Vmn2r19 T A 6: 123,336,535 *855R probably null Het
Other mutations in Vcam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Vcam1 APN 3 116114471 missense possibly damaging 0.85
IGL01546:Vcam1 APN 3 116115942 missense possibly damaging 0.86
IGL01548:Vcam1 APN 3 116115951 missense probably benign 0.06
IGL02070:Vcam1 APN 3 116125997 missense probably benign 0.07
IGL02353:Vcam1 APN 3 116115894 missense possibly damaging 0.53
IGL02360:Vcam1 APN 3 116115894 missense possibly damaging 0.53
K7371:Vcam1 UTSW 3 116124649 missense probably benign 0.00
R0310:Vcam1 UTSW 3 116114416 missense possibly damaging 0.93
R0319:Vcam1 UTSW 3 116116060 missense probably benign 0.01
R0468:Vcam1 UTSW 3 116115946 nonsense probably null
R0638:Vcam1 UTSW 3 116117259 missense possibly damaging 0.71
R1070:Vcam1 UTSW 3 116110903 missense possibly damaging 0.96
R1728:Vcam1 UTSW 3 116114515 missense probably benign 0.16
R1784:Vcam1 UTSW 3 116114515 missense probably benign 0.16
R1956:Vcam1 UTSW 3 116125957 missense probably damaging 1.00
R1957:Vcam1 UTSW 3 116125957 missense probably damaging 1.00
R3052:Vcam1 UTSW 3 116124430 unclassified probably null
R3832:Vcam1 UTSW 3 116114491 missense possibly damaging 0.71
R4297:Vcam1 UTSW 3 116117243 missense probably benign
R4801:Vcam1 UTSW 3 116115935 missense probably damaging 0.98
R4802:Vcam1 UTSW 3 116115935 missense probably damaging 0.98
R4970:Vcam1 UTSW 3 116117292 missense probably benign 0.00
R5073:Vcam1 UTSW 3 116124388 missense probably damaging 1.00
R5074:Vcam1 UTSW 3 116124388 missense probably damaging 1.00
R5112:Vcam1 UTSW 3 116117292 missense probably benign 0.00
R5597:Vcam1 UTSW 3 116126002 missense probably damaging 0.99
R6035:Vcam1 UTSW 3 116125957 missense probably damaging 1.00
R6035:Vcam1 UTSW 3 116125957 missense probably damaging 1.00
R6120:Vcam1 UTSW 3 116124400 missense probably damaging 0.99
R7232:Vcam1 UTSW 3 116125979 missense possibly damaging 0.71
R7350:Vcam1 UTSW 3 116114562 missense probably damaging 0.99
R7384:Vcam1 UTSW 3 116117228 missense possibly damaging 0.81
R7571:Vcam1 UTSW 3 116114383 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACCTAAAATCCGGTGTCCTG -3'
(R):5'- GAGATTCAATTCAGTGGCCCC -3'

Sequencing Primer
(F):5'- ATCCGGTGTCCTGTTCTTTTAATATC -3'
(R):5'- AATTCAGTGGCCCCCTGGAG -3'
Posted On2018-06-22