Incidental Mutation 'R6618:Rdh14'
ID524229
Institutional Source Beutler Lab
Gene Symbol Rdh14
Ensembl Gene ENSMUSG00000020621
Gene Nameretinol dehydrogenase 14 (all-trans and 9-cis)
SynonymsPAN2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R6618 (G1)
Quality Score132.008
Status Validated
Chromosome12
Chromosomal Location10390772-10395562 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10395123 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 325 (I325V)
Ref Sequence ENSEMBL: ENSMUSP00000020947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002456] [ENSMUST00000020947] [ENSMUST00000118657] [ENSMUST00000147323] [ENSMUST00000217944] [ENSMUST00000218026] [ENSMUST00000218287] [ENSMUST00000218327] [ENSMUST00000218339] [ENSMUST00000218417] [ENSMUST00000218551] [ENSMUST00000219049] [ENSMUST00000219292] [ENSMUST00000219826] [ENSMUST00000220257] [ENSMUST00000220611] [ENSMUST00000223534]
Predicted Effect probably benign
Transcript: ENSMUST00000002456
SMART Domains Protein: ENSMUSP00000002456
Gene: ENSMUSG00000020622

DomainStartEndE-ValueType
low complexity region 93 105 N/A INTRINSIC
low complexity region 137 145 N/A INTRINSIC
low complexity region 227 233 N/A INTRINSIC
Pfam:5-nucleotidase 298 570 1.6e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020947
AA Change: I325V

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020947
Gene: ENSMUSG00000020621
AA Change: I325V

DomainStartEndE-ValueType
transmembrane domain 2 21 N/A INTRINSIC
Pfam:KR 45 199 3.4e-10 PFAM
Pfam:adh_short 45 258 5.4e-34 PFAM
Pfam:Epimerase 47 248 7.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118657
SMART Domains Protein: ENSMUSP00000112694
Gene: ENSMUSG00000020622

DomainStartEndE-ValueType
low complexity region 91 103 N/A INTRINSIC
low complexity region 135 143 N/A INTRINSIC
low complexity region 225 231 N/A INTRINSIC
Pfam:5-nucleotidase 280 553 7e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147323
SMART Domains Protein: ENSMUSP00000117869
Gene: ENSMUSG00000020622

DomainStartEndE-ValueType
low complexity region 93 105 N/A INTRINSIC
low complexity region 137 145 N/A INTRINSIC
low complexity region 227 233 N/A INTRINSIC
Pfam:5-nucleotidase 298 466 4.8e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217944
Predicted Effect probably benign
Transcript: ENSMUST00000218026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218148
Predicted Effect probably benign
Transcript: ENSMUST00000218287
Predicted Effect probably benign
Transcript: ENSMUST00000218288
Predicted Effect probably benign
Transcript: ENSMUST00000218327
Predicted Effect probably benign
Transcript: ENSMUST00000218339
Predicted Effect probably benign
Transcript: ENSMUST00000218417
Predicted Effect probably benign
Transcript: ENSMUST00000218551
Predicted Effect probably benign
Transcript: ENSMUST00000219049
Predicted Effect probably benign
Transcript: ENSMUST00000219292
Predicted Effect probably benign
Transcript: ENSMUST00000219630
Predicted Effect probably benign
Transcript: ENSMUST00000219826
Predicted Effect probably benign
Transcript: ENSMUST00000220257
Predicted Effect probably benign
Transcript: ENSMUST00000220611
Predicted Effect probably benign
Transcript: ENSMUST00000223534
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp1b2 T C 11: 69,603,463 D68G probably damaging Het
Barx2 G A 9: 31,846,872 L257F probably benign Het
Bbx C G 16: 50,266,263 W90S probably damaging Het
Bmp1 T A 14: 70,491,368 D588V probably damaging Het
Caskin2 C T 11: 115,800,029 M1188I possibly damaging Het
Ccdc180 T A 4: 45,950,708 I1651N probably damaging Het
Cr2 T C 1: 195,157,379 D580G probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Fam166a C A 2: 25,220,623 L148M probably benign Het
Fam204a T C 19: 60,220,637 probably null Het
Fam71b A G 11: 46,407,299 T477A probably damaging Het
Fam83h T C 15: 76,003,511 D659G probably damaging Het
Hells G T 19: 38,957,084 R589L probably benign Het
Helz A G 11: 107,599,150 T144A probably benign Het
Il1r1 T A 1: 40,300,811 V258D probably damaging Het
Isoc2a A T 7: 4,895,326 I183F probably benign Het
Kat2a G T 11: 100,712,370 probably benign Het
Klf9 A G 19: 23,164,871 M232V probably benign Het
Lars G T 18: 42,244,908 S147R possibly damaging Het
Mfsd7a G T 5: 108,443,098 T400K probably benign Het
Mkrn3 A G 7: 62,419,033 F337L probably benign Het
Mrc2 A T 11: 105,349,882 N1466I probably damaging Het
Myo5c G A 9: 75,275,637 probably null Het
Pigs T C 11: 78,341,230 L396P probably damaging Het
Prkcb G A 7: 122,627,663 R624Q probably benign Het
R3hdm1 T C 1: 128,193,565 S269P probably benign Het
Racgap1 A T 15: 99,623,994 I505K probably damaging Het
Ralgds T A 2: 28,550,511 D777E probably benign Het
Rpn2 T A 2: 157,321,861 H624Q probably benign Het
Scarb1 C T 5: 125,304,330 S50N probably damaging Het
Shmt1 T C 11: 60,792,946 probably null Het
Smim24 A G 10: 81,394,132 N27S possibly damaging Het
Snx13 A G 12: 35,112,445 D550G probably damaging Het
Tnfsf18 T A 1: 161,494,780 L23* probably null Het
Trpc3 T A 3: 36,640,695 K703N possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Zfy2 A G Y: 2,121,477 S139P probably benign Homo
Other mutations in Rdh14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Rdh14 APN 12 10391134 missense probably damaging 0.98
IGL00928:Rdh14 APN 12 10394803 missense probably damaging 1.00
IGL02207:Rdh14 APN 12 10394712 missense possibly damaging 0.81
H8562:Rdh14 UTSW 12 10394709 missense probably damaging 1.00
R1521:Rdh14 UTSW 12 10394613 missense probably damaging 1.00
R1943:Rdh14 UTSW 12 10391162 missense probably benign 0.09
R3980:Rdh14 UTSW 12 10394703 missense probably benign 0.04
R4289:Rdh14 UTSW 12 10394949 missense probably benign 0.00
R4414:Rdh14 UTSW 12 10391231 splice site probably null
R4415:Rdh14 UTSW 12 10391231 splice site probably null
R4417:Rdh14 UTSW 12 10391231 splice site probably null
R4594:Rdh14 UTSW 12 10394567 missense probably damaging 1.00
R5397:Rdh14 UTSW 12 10394869 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGGCATATTCACATCCCACTGC -3'
(R):5'- TAGCCCCAAATAGTAGCAGTGTC -3'

Sequencing Primer
(F):5'- CTGGCAAGACCACTTTTCAATTTGG -3'
(R):5'- GTGTCTTTGAAATATCCATGTGCACC -3'
Posted On2018-06-22