Incidental Mutation 'R6583:Micu2'
ID524249
Institutional Source Beutler Lab
Gene Symbol Micu2
Ensembl Gene ENSMUSG00000021973
Gene Namemitochondrial calcium uptake 2
Synonyms4833427E09Rik, 1110008L20Rik, Efha1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R6583 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location57916261-57999262 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57943670 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 169 (K169R)
Ref Sequence ENSEMBL: ENSMUSP00000022543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022543]
Predicted Effect probably damaging
Transcript: ENSMUST00000022543
AA Change: K169R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022543
Gene: ENSMUSG00000021973
AA Change: K169R

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 35 50 N/A INTRINSIC
EFh 173 201 1.15e0 SMART
EFh 363 391 1.12e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225116
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit an enlarged heart left atrium along with delayed calcium reuptake and decreased relaxation rates by cardiomyocytes, and develop abdominal aortic aneurysms with spontaneous rupture following angiotensin II treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 A C 3: 127,016,964 I491S probably damaging Het
Armc12 A T 17: 28,538,614 Q240L probably null Het
Cntnap5c C T 17: 58,330,277 P1050S probably damaging Het
Col4a3 C A 1: 82,641,476 A42E unknown Het
D630003M21Rik A G 2: 158,220,516 V28A probably damaging Het
Dbf4 A G 5: 8,398,143 S355P probably damaging Het
Dnah6 A G 6: 73,173,533 V749A probably benign Het
Exoc4 T C 6: 33,815,753 L606P probably damaging Het
Fggy T C 4: 95,600,973 S109P probably benign Het
Gdf7 T A 12: 8,301,758 Q59L unknown Het
M6pr T C 6: 122,313,390 V104A probably damaging Het
Macf1 A T 4: 123,470,946 probably null Het
Mthfd1l A G 10: 4,047,937 D636G probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nfib T G 4: 82,498,471 D125A probably damaging Het
Nuf2 T C 1: 169,504,548 T393A probably benign Het
Olfr913 G A 9: 38,594,964 V248I possibly damaging Het
Paox T A 7: 140,126,378 N70K probably damaging Het
Pnmal2 A G 7: 16,945,919 N276S probably damaging Het
Ralgds G A 2: 28,533,644 A32T probably damaging Het
Samd11 T A 4: 156,248,134 N446I possibly damaging Het
Soat1 T C 1: 156,466,492 probably null Het
Tmem87a A T 2: 120,375,477 V339E possibly damaging Het
Tmprss13 G T 9: 45,345,305 C516F probably damaging Het
Vmn2r69 T C 7: 85,409,809 T515A probably benign Het
Xrcc5 T C 1: 72,312,593 probably null Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Zfp964 G T 8: 69,662,983 D78Y probably damaging Het
Other mutations in Micu2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Micu2 APN 14 57943625 missense probably damaging 1.00
IGL02416:Micu2 APN 14 57923965 missense probably damaging 0.99
IGL02675:Micu2 APN 14 57945377 splice site probably benign
IGL03343:Micu2 APN 14 57917311 missense probably benign 0.01
ANU22:Micu2 UTSW 14 57943625 missense probably damaging 1.00
R0238:Micu2 UTSW 14 57917378 splice site probably benign
R0239:Micu2 UTSW 14 57917378 splice site probably benign
R0488:Micu2 UTSW 14 57932242 missense probably benign 0.00
R0564:Micu2 UTSW 14 57919374 missense possibly damaging 0.82
R1116:Micu2 UTSW 14 57954200 missense probably benign 0.00
R1471:Micu2 UTSW 14 57945397 missense probably damaging 0.99
R2011:Micu2 UTSW 14 57954133 splice site probably null
R4226:Micu2 UTSW 14 57932285 missense possibly damaging 0.92
R5595:Micu2 UTSW 14 57971744 missense probably damaging 1.00
R6800:Micu2 UTSW 14 57919439 missense possibly damaging 0.89
R7125:Micu2 UTSW 14 57971781 nonsense probably null
R7205:Micu2 UTSW 14 57954149 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- TGGTTTGATGTCTCACAGGTAAAC -3'
(R):5'- ACAGTGCTTTCCTGGCAAGG -3'

Sequencing Primer
(F):5'- ACTGAAGATGGTTCTGATTTGTAAG -3'
(R):5'- TTTCCTGGCAAGGGCGAG -3'
Posted On2018-06-22