Incidental Mutation 'R6584:Ifna9'
ID524269
Institutional Source Beutler Lab
Gene Symbol Ifna9
Ensembl Gene ENSMUSG00000095270
Gene Nameinterferon alpha 9
SynonymsIfa9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6584 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location88591813-88592385 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88592138 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 83 (L83P)
Ref Sequence ENSEMBL: ENSMUSP00000099871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102807]
Predicted Effect probably damaging
Transcript: ENSMUST00000102807
AA Change: L83P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099871
Gene: ENSMUSG00000095270
AA Change: L83P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IFabd 58 175 1.68e-67 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,718,728 N1122D possibly damaging Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Amfr T C 8: 93,974,155 D559G probably benign Het
Atg2b T C 12: 105,657,995 Y711C probably damaging Het
Clgn T C 8: 83,400,036 I122T probably benign Het
Ets1 T A 9: 32,733,997 F180Y probably damaging Het
Fbxw14 C G 9: 109,286,543 C53S possibly damaging Het
Gm13088 T A 4: 143,655,470 T219S possibly damaging Het
Igf2r A G 17: 12,701,250 C1401R probably damaging Het
Il22 A T 10: 118,205,027 M13L probably benign Het
Il9r A G 11: 32,191,782 Y319H probably benign Het
Itgb5 T C 16: 33,885,030 F230S probably damaging Het
Klk1b27 T A 7: 44,054,511 I26N possibly damaging Het
Lrba C T 3: 86,664,576 R300C probably damaging Het
Map3k4 A C 17: 12,260,491 Y730D probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 G A 5: 27,758,452 H792Y probably damaging Het
Phf20 T C 2: 156,294,123 S621P probably damaging Het
Slitrk3 C A 3: 73,049,225 G738V probably damaging Het
Smurf1 T C 5: 144,882,523 D598G probably damaging Het
St6galnac2 A G 11: 116,694,504 S19P probably benign Het
Stra6l G A 4: 45,869,635 probably null Het
Tbc1d9 C A 8: 83,261,000 Q863K probably damaging Het
Traf1 T A 2: 34,958,058 D8V probably damaging Het
Vmn2r24 T G 6: 123,815,805 M697R possibly damaging Het
Wdr27 T A 17: 14,901,769 Y625F probably damaging Het
Wdr49 T C 3: 75,337,758 M339V probably benign Het
Other mutations in Ifna9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01788:Ifna9 APN 4 88591860 missense probably damaging 1.00
IGL02268:Ifna9 APN 4 88592354 nonsense probably null
R0579:Ifna9 UTSW 4 88592271 missense possibly damaging 0.84
R1530:Ifna9 UTSW 4 88592172 missense possibly damaging 0.83
R1663:Ifna9 UTSW 4 88591983 missense probably benign 0.00
R1872:Ifna9 UTSW 4 88592255 missense probably damaging 0.97
R3923:Ifna9 UTSW 4 88592271 missense possibly damaging 0.84
R4534:Ifna9 UTSW 4 88592048 missense possibly damaging 0.76
R4882:Ifna9 UTSW 4 88592303 missense probably benign 0.01
R5440:Ifna9 UTSW 4 88591811 unclassified probably null
R6008:Ifna9 UTSW 4 88592363 missense probably null 1.00
R6464:Ifna9 UTSW 4 88592250 missense possibly damaging 0.93
R6899:Ifna9 UTSW 4 88592063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCATAGCCAGCTGGGAG -3'
(R):5'- GTGGTGATAAGCTACTGGTCAAC -3'

Sequencing Primer
(F):5'- TCATAGCCAGCTGGGAGTCTTC -3'
(R):5'- GATAAGCTACTGGTCAACCTGCTC -3'
Posted On2018-06-22