Incidental Mutation 'R6584:Amfr'
ID524284
Institutional Source Beutler Lab
Gene Symbol Amfr
Ensembl Gene ENSMUSG00000031751
Gene Nameautocrine motility factor receptor
Synonymsgp78
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.650) question?
Stock #R6584 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location93971588-94012842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93974155 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 559 (D559G)
Ref Sequence ENSEMBL: ENSMUSP00000052258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034198] [ENSMUST00000053766]
Predicted Effect probably benign
Transcript: ENSMUST00000034198
SMART Domains Protein: ENSMUSP00000034198
Gene: ENSMUSG00000031748

DomainStartEndE-ValueType
G_alpha 13 353 2.34e-226 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000053766
AA Change: D559G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000052258
Gene: ENSMUSG00000031751
AA Change: D559G

DomainStartEndE-ValueType
transmembrane domain 78 97 N/A INTRINSIC
transmembrane domain 118 137 N/A INTRINSIC
transmembrane domain 141 158 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
RING 337 374 1.14e-8 SMART
CUE 452 493 3.3e-11 SMART
PDB:4LAD|B 571 596 2e-7 PDB
low complexity region 620 637 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137475
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212008
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a glycosylated transmembrane receptor. Its ligand, autocrine motility factor, is a tumor motility-stimulating protein secreted by tumor cells. The encoded receptor is also a member of the E3 ubiquitin ligase family of proteins. It catalyzes ubiquitination and endoplasmic reticulum-associated degradation of specific proteins. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice for a gene-trapped null allele are obese and develop liver steatosis and/or hepatic inflammation resembling nonalcoholic steatohepatitis. Some mice develop liver tumors. Mice homozygous for another knock-out allele exhibit normal HMGCR turnover in mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,718,728 N1122D possibly damaging Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Atg2b T C 12: 105,657,995 Y711C probably damaging Het
Clgn T C 8: 83,400,036 I122T probably benign Het
Ets1 T A 9: 32,733,997 F180Y probably damaging Het
Fbxw14 C G 9: 109,286,543 C53S possibly damaging Het
Gm13088 T A 4: 143,655,470 T219S possibly damaging Het
Ifna9 A G 4: 88,592,138 L83P probably damaging Het
Igf2r A G 17: 12,701,250 C1401R probably damaging Het
Il22 A T 10: 118,205,027 M13L probably benign Het
Il9r A G 11: 32,191,782 Y319H probably benign Het
Itgb5 T C 16: 33,885,030 F230S probably damaging Het
Klk1b27 T A 7: 44,054,511 I26N possibly damaging Het
Lrba C T 3: 86,664,576 R300C probably damaging Het
Map3k4 A C 17: 12,260,491 Y730D probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 G A 5: 27,758,452 H792Y probably damaging Het
Phf20 T C 2: 156,294,123 S621P probably damaging Het
Slitrk3 C A 3: 73,049,225 G738V probably damaging Het
Smurf1 T C 5: 144,882,523 D598G probably damaging Het
St6galnac2 A G 11: 116,694,504 S19P probably benign Het
Stra6l G A 4: 45,869,635 probably null Het
Tbc1d9 C A 8: 83,261,000 Q863K probably damaging Het
Traf1 T A 2: 34,958,058 D8V probably damaging Het
Vmn2r24 T G 6: 123,815,805 M697R possibly damaging Het
Wdr27 T A 17: 14,901,769 Y625F probably damaging Het
Wdr49 T C 3: 75,337,758 M339V probably benign Het
Other mutations in Amfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Amfr APN 8 93987508 critical splice acceptor site probably null
IGL02169:Amfr APN 8 94005230 splice site probably null
IGL03218:Amfr APN 8 94000336 missense probably damaging 0.97
FR4449:Amfr UTSW 8 94005159 missense probably damaging 1.00
FR4737:Amfr UTSW 8 94005159 missense probably damaging 1.00
FR4976:Amfr UTSW 8 94012292 unclassified probably benign
R0344:Amfr UTSW 8 93987370 splice site probably null
R0532:Amfr UTSW 8 93999108 missense probably damaging 1.00
R1056:Amfr UTSW 8 93985469 missense probably benign 0.27
R1295:Amfr UTSW 8 93974804 missense probably benign 0.26
R1386:Amfr UTSW 8 93985399 missense possibly damaging 0.58
R1450:Amfr UTSW 8 93987747 missense probably benign 0.45
R1613:Amfr UTSW 8 93999226 missense probably benign 0.00
R1703:Amfr UTSW 8 93974243 missense probably benign
R2857:Amfr UTSW 8 94005214 missense probably damaging 1.00
R2858:Amfr UTSW 8 94005214 missense probably damaging 1.00
R2859:Amfr UTSW 8 94005214 missense probably damaging 1.00
R3109:Amfr UTSW 8 94000306 missense probably damaging 1.00
R3708:Amfr UTSW 8 93983320 missense probably benign 0.05
R4456:Amfr UTSW 8 93984940 missense possibly damaging 0.80
R4600:Amfr UTSW 8 93974221 missense probably damaging 0.99
R4952:Amfr UTSW 8 93973159 unclassified probably benign
R5261:Amfr UTSW 8 93976170 critical splice acceptor site probably null
R5391:Amfr UTSW 8 93976048 missense probably damaging 1.00
R5788:Amfr UTSW 8 94000314 missense probably damaging 1.00
R6238:Amfr UTSW 8 94000364 missense probably damaging 1.00
R6795:Amfr UTSW 8 94000333 missense probably benign 0.09
R6955:Amfr UTSW 8 94000376 missense probably damaging 1.00
R6978:Amfr UTSW 8 94000387 missense probably damaging 0.99
R7097:Amfr UTSW 8 94012009 missense probably benign 0.00
R7224:Amfr UTSW 8 93984856 missense probably damaging 1.00
R7260:Amfr UTSW 8 93976148 missense possibly damaging 0.80
R7289:Amfr UTSW 8 93999126 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CTGTCACATGGGTTAACAGTGTTC -3'
(R):5'- GTCTGGCAAAAGTTCCAGCAG -3'

Sequencing Primer
(F):5'- TCCTCAGAGCCAATTCAGGTATAGG -3'
(R):5'- AGTTCCAGCAGACACTTGTG -3'
Posted On2018-06-22