Incidental Mutation 'R6619:Smg6'
ID524290
Institutional Source Beutler Lab
Gene Symbol Smg6
Ensembl Gene ENSMUSG00000038290
Gene NameSmg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_001002764.1; Ensembl: ENSMUST00000045281

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6619 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location74925823-75164448 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 74932453 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045281]
Predicted Effect probably null
Transcript: ENSMUST00000045281
SMART Domains Protein: ENSMUSP00000043555
Gene: ENSMUSG00000038290

DomainStartEndE-ValueType
internal_repeat_1 42 99 7.68e-6 PROSPERO
internal_repeat_1 135 188 7.68e-6 PROSPERO
low complexity region 212 227 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 417 426 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
coiled coil region 574 600 N/A INTRINSIC
Pfam:EST1 637 742 1.8e-18 PFAM
Pfam:EST1_DNA_bind 750 1106 1.6e-78 PFAM
coiled coil region 1197 1234 N/A INTRINSIC
PINc 1245 1396 2.85e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130145
SMART Domains Protein: ENSMUSP00000120229
Gene: ENSMUSG00000038290

DomainStartEndE-ValueType
coiled coil region 35 61 N/A INTRINSIC
Pfam:EST1 99 204 1.3e-19 PFAM
Pfam:EST1_DNA_bind 212 339 7.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158094
Meta Mutation Damage Score 0.59 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the telomerase ribonucleoprotein complex responsible for the replication and maintenance of chromosome ends. The encoded protein also plays a role in the nonsense-mediated mRNA decay (NMD) pathway, providing the endonuclease activity near the premature translation termination codon that is needed to initiate NMD. Alternatively spliced transcript variants encoding distinct protein isoforms have been described. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygosity for insertion of a transgene into intron 6 of the gene results in embryonic lethality. Mice homozygous for a knock-out allele exhibit prenatal lethality. Mice homozygous for a conditional allele activated in embryonic stem cells exhibit defective telomere maintenance and NMD. [provided by MGI curators]
Allele List at MGI

All alleles(52) : Gene trapped(52)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 G A 16: 29,349,015 P109S probably benign Het
Baiap2l1 T C 5: 144,286,106 K106R probably benign Het
Coro6 A G 11: 77,466,204 I111V possibly damaging Het
Crocc2 A G 1: 93,190,501 E382G probably benign Het
Dnah5 C A 15: 28,409,120 N3561K probably benign Het
Dsc2 T A 18: 20,032,278 E879D probably benign Het
Frk A G 10: 34,605,839 Y375C probably benign Het
Gm4756 A T 12: 72,621,950 N44K possibly damaging Het
Herc2 A T 7: 56,068,092 R61* probably null Het
Jarid2 A G 13: 44,874,396 D146G probably damaging Het
Lancl2 C A 6: 57,722,581 T127K probably damaging Het
Large1 G A 8: 72,883,264 Q359* probably null Het
Mast2 C A 4: 116,316,497 E521* probably null Het
Mrc1 T A 2: 14,294,786 probably null Het
Olfr1085 T C 2: 86,658,062 Y132C probably damaging Het
Olfr1427 A G 19: 12,099,363 I92T probably damaging Het
Olfr768 A T 10: 129,093,454 D173E possibly damaging Het
Olfr993 T C 2: 85,414,081 N266S probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
P2ry14 T C 3: 59,115,733 Y102C probably damaging Het
Pcdhga6 T A 18: 37,709,649 D807E probably benign Het
Pcdhgb4 T A 18: 37,721,684 N377K probably damaging Het
Phf13 T A 4: 151,991,657 N263Y probably damaging Het
Rab19 T A 6: 39,388,126 S107T probably damaging Het
Rasgrf2 A T 13: 92,028,519 F380I probably damaging Het
Reep1 T C 6: 71,807,842 probably benign Het
Rnf219 T C 14: 104,522,557 H19R possibly damaging Het
Rpgrip1l C T 8: 91,232,871 E1134K possibly damaging Het
Serpina3m A T 12: 104,391,507 Y230F probably benign Het
Skint3 T C 4: 112,253,864 I62T probably damaging Het
Sp4 G A 12: 118,299,342 T323I possibly damaging Het
Strc A G 2: 121,368,432 I1378T probably damaging Het
Tepsin C T 11: 120,095,602 G128D probably benign Het
Togaram2 A G 17: 71,689,271 N89D probably damaging Het
Trim36 T C 18: 46,188,408 T191A probably damaging Het
Trp53bp1 A T 2: 121,247,499 probably null Het
Zfp418 G A 7: 7,181,896 C286Y probably damaging Het
Other mutations in Smg6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Smg6 APN 11 74929148 missense probably benign
IGL01146:Smg6 APN 11 74930428 nonsense probably null
IGL01505:Smg6 APN 11 75156291 missense probably damaging 1.00
IGL01541:Smg6 APN 11 74925944 missense probably benign 0.43
IGL01636:Smg6 APN 11 74935103 critical splice donor site probably null
IGL02379:Smg6 APN 11 75053925 missense probably damaging 1.00
IGL02794:Smg6 APN 11 75053934 missense probably damaging 0.99
IGL02964:Smg6 APN 11 74930750 critical splice donor site probably null
IGL03057:Smg6 APN 11 74935434 nonsense probably null
1mM(1):Smg6 UTSW 11 74934989 splice site probably benign
IGL03097:Smg6 UTSW 11 74932426 missense probably damaging 1.00
PIT4802001:Smg6 UTSW 11 75156165 missense probably damaging 0.96
R0269:Smg6 UTSW 11 75162931 missense probably benign
R0344:Smg6 UTSW 11 74929821 missense probably damaging 1.00
R0437:Smg6 UTSW 11 74929701 missense probably damaging 1.00
R0452:Smg6 UTSW 11 74930213 missense probably benign
R0511:Smg6 UTSW 11 74929058 missense probably damaging 1.00
R0617:Smg6 UTSW 11 75162931 missense probably benign
R0737:Smg6 UTSW 11 75159836 missense probably damaging 1.00
R1715:Smg6 UTSW 11 74929430 missense probably benign
R1780:Smg6 UTSW 11 74946116 missense probably damaging 1.00
R1927:Smg6 UTSW 11 75142848 missense probably damaging 1.00
R2073:Smg6 UTSW 11 74930294 missense probably damaging 1.00
R2171:Smg6 UTSW 11 75038646 missense probably damaging 1.00
R2513:Smg6 UTSW 11 74929676 missense probably damaging 1.00
R3943:Smg6 UTSW 11 74929541 missense probably damaging 1.00
R3944:Smg6 UTSW 11 74929541 missense probably damaging 1.00
R4275:Smg6 UTSW 11 74993874 intron probably benign
R4369:Smg6 UTSW 11 74932443 nonsense probably null
R4452:Smg6 UTSW 11 74990141 missense probably benign 0.14
R4864:Smg6 UTSW 11 74930162 missense possibly damaging 0.89
R4885:Smg6 UTSW 11 75041918 missense probably damaging 1.00
R5043:Smg6 UTSW 11 74929895 missense possibly damaging 0.86
R5189:Smg6 UTSW 11 75041996 missense probably damaging 1.00
R5378:Smg6 UTSW 11 75041994 missense possibly damaging 0.61
R5518:Smg6 UTSW 11 75053898 missense probably damaging 0.99
R5725:Smg6 UTSW 11 74930613 missense probably benign 0.45
R5746:Smg6 UTSW 11 75139287 missense probably damaging 1.00
R6151:Smg6 UTSW 11 75156207 missense probably damaging 0.96
R6319:Smg6 UTSW 11 75156222 missense probably damaging 1.00
R6349:Smg6 UTSW 11 75053774 missense possibly damaging 0.94
R6500:Smg6 UTSW 11 74930505 missense possibly damaging 0.74
R6820:Smg6 UTSW 11 75041964 missense probably damaging 0.99
R6923:Smg6 UTSW 11 74929343 missense possibly damaging 0.50
X0018:Smg6 UTSW 11 74929986 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AAGGGTTGTTTGGCCAAGG -3'
(R):5'- TGTCCTGCTTATGACTATTAGTTGT -3'

Sequencing Primer
(F):5'- AAGGGTTGTTTGGCCAAGGATTTG -3'
(R):5'- AGAGGCCCTGAGTTCAATTC -3'
Posted On2018-06-22