Incidental Mutation 'R6584:Atg2b'
ID524299
Institutional Source Beutler Lab
Gene Symbol Atg2b
Ensembl Gene ENSMUSG00000041341
Gene Nameautophagy related 2B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.316) question?
Stock #R6584 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location105616136-105685211 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105657995 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 711 (Y711C)
Ref Sequence ENSEMBL: ENSMUSP00000037441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041055]
Predicted Effect probably damaging
Transcript: ENSMUST00000041055
AA Change: Y711C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037441
Gene: ENSMUSG00000041341
AA Change: Y711C

DomainStartEndE-ValueType
Pfam:Chorein_N 11 127 3.5e-19 PFAM
low complexity region 286 298 N/A INTRINSIC
low complexity region 409 428 N/A INTRINSIC
low complexity region 864 870 N/A INTRINSIC
low complexity region 893 904 N/A INTRINSIC
low complexity region 1722 1733 N/A INTRINSIC
Pfam:ATG_C 1976 2071 1.4e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221568
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein required for autophagy. The encoded protein is involved in autophagosome formation. A germline duplication of a region that includes this gene is associated with predisposition to myeloid malignancies. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,718,728 N1122D possibly damaging Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Amfr T C 8: 93,974,155 D559G probably benign Het
Clgn T C 8: 83,400,036 I122T probably benign Het
Ets1 T A 9: 32,733,997 F180Y probably damaging Het
Fbxw14 C G 9: 109,286,543 C53S possibly damaging Het
Gm13088 T A 4: 143,655,470 T219S possibly damaging Het
Ifna9 A G 4: 88,592,138 L83P probably damaging Het
Igf2r A G 17: 12,701,250 C1401R probably damaging Het
Il22 A T 10: 118,205,027 M13L probably benign Het
Il9r A G 11: 32,191,782 Y319H probably benign Het
Itgb5 T C 16: 33,885,030 F230S probably damaging Het
Klk1b27 T A 7: 44,054,511 I26N possibly damaging Het
Lrba C T 3: 86,664,576 R300C probably damaging Het
Map3k4 A C 17: 12,260,491 Y730D probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 G A 5: 27,758,452 H792Y probably damaging Het
Phf20 T C 2: 156,294,123 S621P probably damaging Het
Slitrk3 C A 3: 73,049,225 G738V probably damaging Het
Smurf1 T C 5: 144,882,523 D598G probably damaging Het
St6galnac2 A G 11: 116,694,504 S19P probably benign Het
Stra6l G A 4: 45,869,635 probably null Het
Tbc1d9 C A 8: 83,261,000 Q863K probably damaging Het
Traf1 T A 2: 34,958,058 D8V probably damaging Het
Vmn2r24 T G 6: 123,815,805 M697R possibly damaging Het
Wdr27 T A 17: 14,901,769 Y625F probably damaging Het
Wdr49 T C 3: 75,337,758 M339V probably benign Het
Other mutations in Atg2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Atg2b APN 12 105644916 missense probably benign 0.20
IGL01326:Atg2b APN 12 105622144 missense probably damaging 1.00
IGL02063:Atg2b APN 12 105648322 missense possibly damaging 0.89
IGL02260:Atg2b APN 12 105636440 splice site probably benign
IGL02376:Atg2b APN 12 105645468 missense probably damaging 1.00
IGL02381:Atg2b APN 12 105648348 missense probably damaging 1.00
IGL02434:Atg2b APN 12 105639207 missense probably benign 0.00
IGL02534:Atg2b APN 12 105643267 missense probably damaging 1.00
IGL03011:Atg2b APN 12 105626362 missense probably damaging 0.98
IGL03173:Atg2b APN 12 105658294 missense possibly damaging 0.68
R6669_Atg2b_067 UTSW 12 105671529 missense possibly damaging 0.90
R0066:Atg2b UTSW 12 105648449 missense probably benign
R0066:Atg2b UTSW 12 105648449 missense probably benign
R0511:Atg2b UTSW 12 105617153 missense probably damaging 1.00
R0762:Atg2b UTSW 12 105674970 missense possibly damaging 0.56
R0786:Atg2b UTSW 12 105636508 missense probably benign 0.00
R1029:Atg2b UTSW 12 105635773 missense probably damaging 0.96
R1529:Atg2b UTSW 12 105661133 missense probably benign
R1563:Atg2b UTSW 12 105623488 missense probably damaging 0.99
R1746:Atg2b UTSW 12 105669329 missense possibly damaging 0.79
R1887:Atg2b UTSW 12 105654092 missense probably benign 0.01
R1956:Atg2b UTSW 12 105669418 missense probably damaging 1.00
R1957:Atg2b UTSW 12 105669418 missense probably damaging 1.00
R2272:Atg2b UTSW 12 105638008 missense probably benign 0.00
R2877:Atg2b UTSW 12 105664009 nonsense probably null
R2878:Atg2b UTSW 12 105664009 nonsense probably null
R4798:Atg2b UTSW 12 105652629 missense probably benign 0.37
R4836:Atg2b UTSW 12 105646814 missense probably benign
R5007:Atg2b UTSW 12 105643876 splice site probably null
R5042:Atg2b UTSW 12 105621262 missense probably benign 0.01
R5134:Atg2b UTSW 12 105674950 missense probably damaging 0.96
R5212:Atg2b UTSW 12 105646796 missense probably benign 0.00
R5250:Atg2b UTSW 12 105635765 missense probably damaging 1.00
R5307:Atg2b UTSW 12 105658329 missense probably benign 0.17
R5342:Atg2b UTSW 12 105658916 missense possibly damaging 0.90
R5583:Atg2b UTSW 12 105649155 missense possibly damaging 0.94
R5656:Atg2b UTSW 12 105621328 missense probably benign 0.00
R5660:Atg2b UTSW 12 105649124 nonsense probably null
R5903:Atg2b UTSW 12 105639359 missense possibly damaging 0.90
R6018:Atg2b UTSW 12 105661171 missense probably damaging 0.96
R6153:Atg2b UTSW 12 105623482 missense possibly damaging 0.80
R6326:Atg2b UTSW 12 105661092 nonsense probably null
R6593:Atg2b UTSW 12 105644848 missense probably damaging 1.00
R6669:Atg2b UTSW 12 105671529 missense possibly damaging 0.90
R6847:Atg2b UTSW 12 105635788 missense probably damaging 1.00
R7003:Atg2b UTSW 12 105654249 missense probably benign 0.01
R7193:Atg2b UTSW 12 105664708 missense probably damaging 1.00
R7387:Atg2b UTSW 12 105622775 missense probably damaging 1.00
X0018:Atg2b UTSW 12 105666697 missense possibly damaging 0.86
X0066:Atg2b UTSW 12 105646785 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGCAACTTTTCTGGCTTTGGTC -3'
(R):5'- TCAGCTTCACTATAAACACTCAGAG -3'

Sequencing Primer
(F):5'- TGTCTAGGGAGCCATCTCAAG -3'
(R):5'- CTCAGAGACTAGAGGACCCCAGG -3'
Posted On2018-06-22