Incidental Mutation 'R6619:Jarid2'
ID524302
Institutional Source Beutler Lab
Gene Symbol Jarid2
Ensembl Gene ENSMUSG00000038518
Gene Namejumonji, AT rich interactive domain 2
Synonymsjumonji, Jmj
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6619 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location44729474-44921643 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44874396 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 146 (D146G)
Ref Sequence ENSEMBL: ENSMUSP00000134675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044608] [ENSMUST00000172977] [ENSMUST00000173003] [ENSMUST00000173246] [ENSMUST00000173367] [ENSMUST00000173704] [ENSMUST00000173906]
Predicted Effect probably damaging
Transcript: ENSMUST00000044608
AA Change: D146G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037774
Gene: ENSMUSG00000038518
AA Change: D146G

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
JmjN 554 595 1.77e-20 SMART
ARID 616 707 4.96e-24 SMART
BRIGHT 620 712 1.7e-29 SMART
low complexity region 791 800 N/A INTRINSIC
JmjC 882 1046 1.04e-50 SMART
Pfam:zf-C5HC2 1137 1191 2.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172924
Predicted Effect probably benign
Transcript: ENSMUST00000172977
SMART Domains Protein: ENSMUSP00000134276
Gene: ENSMUSG00000038518

DomainStartEndE-ValueType
Blast:JmjC 8 61 4e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173003
Predicted Effect probably damaging
Transcript: ENSMUST00000173246
AA Change: D146G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134205
Gene: ENSMUSG00000038518
AA Change: D146G

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
JmjN 554 595 1.77e-20 SMART
ARID 616 707 4.96e-24 SMART
BRIGHT 620 712 1.7e-29 SMART
low complexity region 791 800 N/A INTRINSIC
JmjC 882 1046 1.04e-50 SMART
Pfam:zf-C5HC2 1137 1191 2.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173367
SMART Domains Protein: ENSMUSP00000134658
Gene: ENSMUSG00000038518

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
low complexity region 126 146 N/A INTRINSIC
low complexity region 195 214 N/A INTRINSIC
JmjN 415 456 1.77e-20 SMART
PDB:2RQ5|A 476 507 3e-14 PDB
Blast:ARID 477 507 2e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000173704
AA Change: D146G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134675
Gene: ENSMUSG00000038518
AA Change: D146G

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
JmjN 554 595 1.77e-20 SMART
ARID 616 707 4.96e-24 SMART
BRIGHT 620 712 1.7e-29 SMART
low complexity region 791 800 N/A INTRINSIC
JmjC 882 1046 1.04e-50 SMART
Pfam:zf-C5HC2 1137 1190 1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173906
AA Change: D108G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134630
Gene: ENSMUSG00000038518
AA Change: D108G

DomainStartEndE-ValueType
low complexity region 48 61 N/A INTRINSIC
low complexity region 143 157 N/A INTRINSIC
low complexity region 227 247 N/A INTRINSIC
low complexity region 296 315 N/A INTRINSIC
JmjN 516 557 1.77e-20 SMART
ARID 578 669 4.96e-24 SMART
BRIGHT 582 674 1.7e-29 SMART
low complexity region 753 762 N/A INTRINSIC
JmjC 844 1008 1.04e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174683
Meta Mutation Damage Score 0.362 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Jumonji- and AT-rich interaction domain (ARID)-domain-containing protein. The encoded protein is a DNA-binding protein that functions as a transcriptional repressor. This protein interacts with the Polycomb repressive complex 2 (PRC2) which plays an essential role in regulating gene expression during embryonic development. This protein facilitates the recruitment of the PRC2 complex to target genes. Alternate splicing results in multiple transcript variants. Mutations in this gene are associated with chronic myeloid malignancies. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutants show strain-specific phenotypes, including embryonic death and defective neural tube closure, impaired hematopoiesis and hypoplasia of liver, thymus and spleen. Homozygotes for another mutation die at birth with cardiac defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 G A 16: 29,349,015 P109S probably benign Het
Baiap2l1 T C 5: 144,286,106 K106R probably benign Het
Coro6 A G 11: 77,466,204 I111V possibly damaging Het
Crocc2 A G 1: 93,190,501 E382G probably benign Het
Dnah5 C A 15: 28,409,120 N3561K probably benign Het
Dsc2 T A 18: 20,032,278 E879D probably benign Het
Frk A G 10: 34,605,839 Y375C probably benign Het
Gm4756 A T 12: 72,621,950 N44K possibly damaging Het
Herc2 A T 7: 56,068,092 R61* probably null Het
Lancl2 C A 6: 57,722,581 T127K probably damaging Het
Large1 G A 8: 72,883,264 Q359* probably null Het
Mast2 C A 4: 116,316,497 E521* probably null Het
Mrc1 T A 2: 14,294,786 probably null Het
Olfr1085 T C 2: 86,658,062 Y132C probably damaging Het
Olfr1427 A G 19: 12,099,363 I92T probably damaging Het
Olfr768 A T 10: 129,093,454 D173E possibly damaging Het
Olfr993 T C 2: 85,414,081 N266S probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
P2ry14 T C 3: 59,115,733 Y102C probably damaging Het
Pcdhga6 T A 18: 37,709,649 D807E probably benign Het
Pcdhgb4 T A 18: 37,721,684 N377K probably damaging Het
Phf13 T A 4: 151,991,657 N263Y probably damaging Het
Rab19 T A 6: 39,388,126 S107T probably damaging Het
Rasgrf2 A T 13: 92,028,519 F380I probably damaging Het
Reep1 T C 6: 71,807,842 probably benign Het
Rnf219 T C 14: 104,522,557 H19R possibly damaging Het
Rpgrip1l C T 8: 91,232,871 E1134K possibly damaging Het
Serpina3m A T 12: 104,391,507 Y230F probably benign Het
Skint3 T C 4: 112,253,864 I62T probably damaging Het
Smg6 T C 11: 74,932,453 probably null Het
Sp4 G A 12: 118,299,342 T323I possibly damaging Het
Strc A G 2: 121,368,432 I1378T probably damaging Het
Tepsin C T 11: 120,095,602 G128D probably benign Het
Togaram2 A G 17: 71,689,271 N89D probably damaging Het
Trim36 T C 18: 46,188,408 T191A probably damaging Het
Trp53bp1 A T 2: 121,247,499 probably null Het
Zfp418 G A 7: 7,181,896 C286Y probably damaging Het
Other mutations in Jarid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01572:Jarid2 APN 13 44884835 missense probably damaging 1.00
IGL02217:Jarid2 APN 13 44913201 missense probably damaging 1.00
IGL02378:Jarid2 APN 13 44914325 missense probably damaging 0.98
IGL02604:Jarid2 APN 13 44874401 missense probably damaging 1.00
IGL02865:Jarid2 APN 13 44910560 missense probably damaging 1.00
IGL02926:Jarid2 APN 13 44902929 missense probably benign 0.03
R0057:Jarid2 UTSW 13 44884856 missense probably damaging 0.96
R0426:Jarid2 UTSW 13 44840882 critical splice donor site probably null
R0545:Jarid2 UTSW 13 44902831 missense probably benign 0.10
R0562:Jarid2 UTSW 13 44902359 missense probably damaging 0.99
R1192:Jarid2 UTSW 13 44906545 missense probably damaging 1.00
R1241:Jarid2 UTSW 13 44884892 splice site probably benign
R1254:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1464:Jarid2 UTSW 13 44848381 missense probably damaging 0.97
R1464:Jarid2 UTSW 13 44848381 missense probably damaging 0.97
R1552:Jarid2 UTSW 13 44911199 missense probably damaging 1.00
R1728:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1729:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1730:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1739:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1783:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1785:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1844:Jarid2 UTSW 13 44902743 missense possibly damaging 0.71
R1896:Jarid2 UTSW 13 44884882 critical splice donor site probably null
R1965:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1966:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1995:Jarid2 UTSW 13 44874441 missense probably damaging 1.00
R2120:Jarid2 UTSW 13 44906336 missense probably benign 0.17
R2142:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R2172:Jarid2 UTSW 13 44902539 missense probably damaging 0.99
R2242:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R2245:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3110:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3111:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3112:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3115:Jarid2 UTSW 13 44896466 missense probably damaging 1.00
R3620:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3704:Jarid2 UTSW 13 44902355 missense probably benign
R3802:Jarid2 UTSW 13 44902831 missense probably benign 0.10
R3804:Jarid2 UTSW 13 44902831 missense probably benign 0.10
R4126:Jarid2 UTSW 13 44902256 missense probably damaging 1.00
R4127:Jarid2 UTSW 13 44902256 missense probably damaging 1.00
R4128:Jarid2 UTSW 13 44902256 missense probably damaging 1.00
R4153:Jarid2 UTSW 13 44910426 missense probably damaging 1.00
R4844:Jarid2 UTSW 13 44913772 missense probably damaging 0.96
R5044:Jarid2 UTSW 13 44906565 missense probably damaging 1.00
R5329:Jarid2 UTSW 13 44906271 missense possibly damaging 0.49
R5632:Jarid2 UTSW 13 44896290 missense probably damaging 0.97
R5820:Jarid2 UTSW 13 44902301 missense possibly damaging 0.96
R6267:Jarid2 UTSW 13 44903063 missense possibly damaging 0.93
R6296:Jarid2 UTSW 13 44903063 missense possibly damaging 0.93
R6479:Jarid2 UTSW 13 44848289 missense probably benign 0.22
R6633:Jarid2 UTSW 13 44884877 missense probably damaging 0.97
R6970:Jarid2 UTSW 13 44902985 missense probably damaging 1.00
R7020:Jarid2 UTSW 13 44884824 missense probably damaging 1.00
R7155:Jarid2 UTSW 13 44902462 missense probably damaging 1.00
R7223:Jarid2 UTSW 13 44896322 missense possibly damaging 0.89
R7265:Jarid2 UTSW 13 44902272 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TACTGCTGCATGAGGTCCTG -3'
(R):5'- CTCAGAAGGTGGAATAAGGCAAATCTC -3'

Sequencing Primer
(F):5'- GCATGAGGTCCTGTATTCTCCAG -3'
(R):5'- TCATATACACAGAGTCTAGTATGCCC -3'
Posted On2018-06-22