Incidental Mutation 'R6585:Adam1b'
ID524334
Institutional Source Beutler Lab
Gene Symbol Adam1b
Ensembl Gene ENSMUSG00000062438
Gene Namea disintegrin and metallopeptidase domain 1b
SynonymsPH-30 alpha, Ftna, fertilin alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6585 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location121500098-121503435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 121501187 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 598 (D598E)
Ref Sequence ENSEMBL: ENSMUSP00000078343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079368] [ENSMUST00000111795] [ENSMUST00000156080]
Predicted Effect probably benign
Transcript: ENSMUST00000079368
AA Change: D598E

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000078343
Gene: ENSMUSG00000062438
AA Change: D598E

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Pep_M12B_propep 38 159 1.6e-18 PFAM
Pfam:Reprolysin_5 201 378 2.9e-15 PFAM
Pfam:Reprolysin_4 202 386 6.8e-9 PFAM
Pfam:Reprolysin 203 397 2.4e-70 PFAM
Pfam:Reprolysin_3 223 349 3.9e-14 PFAM
Pfam:Reprolysin_2 223 387 5.8e-9 PFAM
DISIN 415 488 8.08e-29 SMART
ACR 489 628 3.41e-47 SMART
EGF 634 665 2.34e1 SMART
transmembrane domain 705 727 N/A INTRINSIC
coiled coil region 763 801 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111795
SMART Domains Protein: ENSMUSP00000144614
Gene: ENSMUSG00000029452

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156080
SMART Domains Protein: ENSMUSP00000121579
Gene: ENSMUSG00000029452

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
transmembrane domain 140 162 N/A INTRINSIC
transmembrane domain 205 227 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196484
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 97% (30/31)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, healthy and fertile with no significant defects in sperm function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,737,668 C108Y probably damaging Het
AA792892 C T 5: 94,381,556 P62S probably benign Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Ascc3 A G 10: 50,842,177 K1989E probably benign Het
Chd1l A G 3: 97,597,772 F160L probably damaging Het
Ciita T A 16: 10,511,745 V628E probably benign Het
Dis3l2 T A 1: 86,745,494 I69N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Elp2 T C 18: 24,625,549 L503S probably damaging Het
Fcgbp A T 7: 28,113,979 Q2313L possibly damaging Het
Gm14851 A G 8: 21,095,232 C65R possibly damaging Het
Gpr155 A T 2: 73,349,645 I157N probably damaging Het
Hist2h2bb A T 3: 96,270,097 T116S probably benign Het
Kcnj1 T C 9: 32,397,261 V307A probably benign Het
Lama3 G A 18: 12,419,257 probably null Het
Lrp6 A T 6: 134,507,558 Y367* probably null Het
Ms4a14 T A 19: 11,303,645 Q516H unknown Het
Nprl3 C T 11: 32,234,812 R399Q probably benign Het
Olfr273 A T 4: 52,856,192 M107K possibly damaging Het
Olfr290 A T 7: 84,916,462 I228F probably damaging Het
Park7 G T 4: 150,905,264 Q80K probably benign Het
Pramef20 C A 4: 144,377,030 L175F possibly damaging Het
Ptgs2 T C 1: 150,103,987 V281A possibly damaging Het
Rprd1a T C 18: 24,506,663 probably null Het
Speer4f2 A G 5: 17,374,422 E73G probably damaging Het
Spta1 T C 1: 174,178,685 W138R probably damaging Het
U2surp T C 9: 95,472,071 E838G probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp19 G T 9: 108,499,727 L1165F probably damaging Het
Zfp27 G A 7: 29,896,393 T49I possibly damaging Het
Other mutations in Adam1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adam1b APN 5 121500993 missense probably damaging 0.96
IGL01696:Adam1b APN 5 121500793 missense possibly damaging 0.73
IGL01906:Adam1b APN 5 121501475 missense probably benign 0.00
IGL02003:Adam1b APN 5 121501291 missense probably damaging 1.00
IGL02438:Adam1b APN 5 121501038 missense probably damaging 1.00
IGL02479:Adam1b APN 5 121501398 missense probably damaging 1.00
IGL03258:Adam1b APN 5 121501384 missense possibly damaging 0.94
PIT4519001:Adam1b UTSW 5 121501947 missense probably damaging 1.00
R1695:Adam1b UTSW 5 121500907 missense probably benign 0.02
R1816:Adam1b UTSW 5 121501725 missense probably damaging 0.99
R1831:Adam1b UTSW 5 121502937 missense possibly damaging 0.67
R1833:Adam1b UTSW 5 121502937 missense possibly damaging 0.67
R1839:Adam1b UTSW 5 121501041 missense probably damaging 1.00
R2031:Adam1b UTSW 5 121501055 missense possibly damaging 0.73
R2110:Adam1b UTSW 5 121500714 intron probably benign
R2112:Adam1b UTSW 5 121500714 intron probably benign
R2570:Adam1b UTSW 5 121501748 missense probably damaging 1.00
R3020:Adam1b UTSW 5 121501383 missense possibly damaging 0.67
R4573:Adam1b UTSW 5 121500793 missense probably benign 0.18
R4574:Adam1b UTSW 5 121500793 missense probably benign 0.18
R5023:Adam1b UTSW 5 121501159 missense probably damaging 1.00
R5364:Adam1b UTSW 5 121500883 missense possibly damaging 0.75
R6553:Adam1b UTSW 5 121501187 missense probably benign 0.05
R6600:Adam1b UTSW 5 121501467 missense probably damaging 1.00
R7285:Adam1b UTSW 5 121500993 missense probably damaging 0.96
R7549:Adam1b UTSW 5 121501918 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTCTTTGCAGTCGGGAG -3'
(R):5'- TCTGAACTCGAGAGGAGACC -3'

Sequencing Primer
(F):5'- TCGGGAGGTGCAAAGCC -3'
(R):5'- AGTTTGGAAACTGTGGCTCCTCC -3'
Posted On2018-06-22