Incidental Mutation 'R6648:Fpgs'
ID524335
Institutional Source Beutler Lab
Gene Symbol Fpgs
Ensembl Gene ENSMUSG00000009566
Gene Namefolylpolyglutamyl synthetase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R6648 (G1)
Quality Score167.009
Status Validated
Chromosome2
Chromosomal Location32682609-32704145 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 32684787 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 439 (C439*)
Ref Sequence ENSEMBL: ENSMUSP00000028148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009705] [ENSMUST00000028148] [ENSMUST00000113272] [ENSMUST00000127812] [ENSMUST00000146498] [ENSMUST00000167841]
Predicted Effect probably benign
Transcript: ENSMUST00000009705
SMART Domains Protein: ENSMUSP00000009705
Gene: ENSMUSG00000026814

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 336 346 N/A INTRINSIC
ZP 362 569 1.29e-2 SMART
transmembrane domain 587 609 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000028148
AA Change: C439*
SMART Domains Protein: ENSMUSP00000028148
Gene: ENSMUSG00000009566
AA Change: C439*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1jbwa2 43 327 1e-59 SMART
PDB:1O5Z|A 99 389 2e-37 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000113272
SMART Domains Protein: ENSMUSP00000108897
Gene: ENSMUSG00000026814

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
ZP 361 568 1.29e-2 SMART
transmembrane domain 586 608 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123171
Predicted Effect probably benign
Transcript: ENSMUST00000127812
SMART Domains Protein: ENSMUSP00000116434
Gene: ENSMUSG00000009566

DomainStartEndE-ValueType
SCOP:d1jbwa2 40 243 3e-48 SMART
PDB:1O5Z|A 56 243 4e-30 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142186
Predicted Effect probably benign
Transcript: ENSMUST00000146498
SMART Domains Protein: ENSMUSP00000141899
Gene: ENSMUSG00000009566

DomainStartEndE-ValueType
SCOP:d1jbwa2 40 126 2e-14 SMART
low complexity region 136 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156306
SMART Domains Protein: ENSMUSP00000122186
Gene: ENSMUSG00000026814

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
ZP 52 283 1.23e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156792
Predicted Effect probably benign
Transcript: ENSMUST00000167841
SMART Domains Protein: ENSMUSP00000130585
Gene: ENSMUSG00000026814

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 336 346 N/A INTRINSIC
ZP 362 569 1.29e-2 SMART
transmembrane domain 587 609 N/A INTRINSIC
low complexity region 616 625 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185043
Meta Mutation Damage Score 0.528 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the folylpolyglutamate synthetase enzyme. This enzyme has a central role in establishing and maintaining both cytosolic and mitochondrial folylpolyglutamate concentrations and, therefore, is essential for folate homeostasis and the survival of proliferating cells. This enzyme catalyzes the ATP-dependent addition of glutamate moieties to folate and folate derivatives. Alternative splicing results in transcript variants encoding different isoforms. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik T A 1: 43,738,691 F87I probably damaging Het
Aars2 T C 17: 45,516,564 Y511H probably damaging Het
Arhgef38 A T 3: 133,132,475 I600N probably damaging Het
Cacna1g A T 11: 94,432,569 C1270S probably damaging Het
Ccar2 T G 14: 70,139,225 D890A probably benign Het
Cep76 A T 18: 67,619,734 V548D probably benign Het
Chat T G 14: 32,454,694 Q41P probably benign Het
Ddx24 T A 12: 103,408,375 N850I probably benign Het
Dst A G 1: 34,262,041 I5879V possibly damaging Het
Ece1 A G 4: 137,921,159 T92A probably benign Het
Gm21994 T C 2: 150,255,177 I111V probably benign Het
H2-Q4 A T 17: 35,383,005 E281V probably damaging Het
Hydin A G 8: 110,525,667 probably null Het
Iqgap2 T C 13: 95,682,211 E679G probably benign Het
Kif12 A T 4: 63,171,317 probably null Het
Kif21b T C 1: 136,152,397 V557A probably benign Het
Mki67 C G 7: 135,697,440 S1955T probably damaging Het
Mybpc1 G A 10: 88,522,999 T1110M probably damaging Het
Myh9 T C 15: 77,766,772 H1625R probably benign Het
Nbeal2 G A 9: 110,637,642 T704M probably damaging Het
Olfr1378 G A 11: 50,969,173 D52N probably damaging Het
Olfr1438-ps1 A T 19: 12,333,766 M30K probably benign Het
Osbpl9 C A 4: 109,091,679 Q91H possibly damaging Het
Pcsk5 A T 19: 17,575,821 L665Q probably damaging Het
Pgm5 T C 19: 24,861,632 D53G probably benign Het
Plcd4 A G 1: 74,552,013 D189G probably benign Het
Plxnb1 A T 9: 109,104,330 Q676L probably benign Het
Prss33 A G 17: 23,834,702 S134P probably benign Het
Rln1 G T 19: 29,332,121 T86K probably benign Het
Rnf213 G A 11: 119,479,920 A4785T possibly damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sh3tc2 T C 18: 62,015,040 C1274R probably benign Het
Slc35a5 A T 16: 45,143,917 F318I probably damaging Het
Slc41a3 T C 6: 90,619,508 F20L probably damaging Het
Socs4 T A 14: 47,290,176 N189K probably benign Het
Tiam2 A T 17: 3,506,873 E1196V probably damaging Het
Tmc3 T A 7: 83,597,543 V164D probably damaging Het
Trim46 T C 3: 89,235,242 E623G possibly damaging Het
Ubr4 C A 4: 139,452,719 C3403* probably null Het
Vmn1r194 A T 13: 22,244,524 T104S probably benign Het
Vmn2r112 A T 17: 22,618,486 I643F probably damaging Het
Zmynd11 T G 13: 9,713,021 S95R probably benign Het
Zswim4 C A 8: 84,230,914 R175L probably benign Het
Other mutations in Fpgs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Fpgs APN 2 32686547 unclassified probably benign
IGL00493:Fpgs APN 2 32687997 missense possibly damaging 0.49
IGL02397:Fpgs APN 2 32685789 missense probably damaging 1.00
IGL02867:Fpgs APN 2 32685879 unclassified probably benign
IGL02889:Fpgs APN 2 32685879 unclassified probably benign
IGL03082:Fpgs APN 2 32685757 nonsense probably null
IGL03126:Fpgs APN 2 32683123 missense possibly damaging 0.86
R0243:Fpgs UTSW 2 32692494 nonsense probably null
R0312:Fpgs UTSW 2 32684801 missense probably damaging 0.99
R1326:Fpgs UTSW 2 32692580 unclassified probably null
R1558:Fpgs UTSW 2 32685840 missense possibly damaging 0.77
R1624:Fpgs UTSW 2 32691188 critical splice donor site probably null
R1934:Fpgs UTSW 2 32687981 missense probably damaging 1.00
R3706:Fpgs UTSW 2 32687996 missense probably damaging 1.00
R4439:Fpgs UTSW 2 32687501 missense probably damaging 1.00
R4440:Fpgs UTSW 2 32687501 missense probably damaging 1.00
R4868:Fpgs UTSW 2 32692661 missense probably damaging 1.00
R4979:Fpgs UTSW 2 32687367 unclassified probably benign
R5279:Fpgs UTSW 2 32692767 intron probably benign
R6337:Fpgs UTSW 2 32687941 nonsense probably null
R6668:Fpgs UTSW 2 32687606 missense probably benign 0.05
R6768:Fpgs UTSW 2 32686623 missense probably benign 0.01
R7134:Fpgs UTSW 2 32686629 missense probably benign 0.25
R7360:Fpgs UTSW 2 32693993 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GTGCTGTGACTACATGCCATAAC -3'
(R):5'- TGGCTCGTTACTACACATCC -3'

Sequencing Primer
(F):5'- TAAAATCTACATACCCTGGGGCTGG -3'
(R):5'- GTTACTACACATCCCAGTGCAGG -3'
Posted On2018-06-22