Incidental Mutation 'R6587:Krt78'
ID524471
Institutional Source Beutler Lab
Gene Symbol Krt78
Ensembl Gene ENSMUSG00000050463
Gene Namekeratin 78
Synonyms2310030B04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6587 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location101946001-101954287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101952269 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 201 (K201R)
Ref Sequence ENSEMBL: ENSMUSP00000126197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164932]
Predicted Effect probably benign
Transcript: ENSMUST00000164932
AA Change: K201R

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000126197
Gene: ENSMUSG00000050463
AA Change: K201R

DomainStartEndE-ValueType
Pfam:Keratin_2_head 2 101 5.7e-16 PFAM
Filament 104 417 1.38e-133 SMART
internal_repeat_1 421 660 8.87e-74 PROSPERO
internal_repeat_1 704 957 8.87e-74 PROSPERO
low complexity region 1033 1049 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin gene family and encodes a protein with an intermediate filament domain. Keratins are the major structural proteins in epithelial cells, forming a cytoplasmic network of 10 to 12 nm wide intermediate filaments and creating a scaffold that gives cells the ability to withstand mechanical and non-mechanical stresses. The genes of the type II keratin family are located as a gene cluster at 12p13.13. Four pseudogenes of this gene family have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc2 TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG 2: 25,272,538 probably benign Het
Ank3 G T 10: 69,990,152 probably benign Het
Ano3 C A 2: 110,797,904 probably null Het
Arhgap39 A G 15: 76,737,499 S301P probably damaging Het
Atad2 G T 15: 58,121,048 Q295K probably benign Het
Camkmt T C 17: 85,113,815 V115A possibly damaging Het
Cenpf T C 1: 189,658,374 E1087G probably damaging Het
Cfhr2 T A 1: 139,810,858 I322F probably benign Het
Chil6 T C 3: 106,404,881 M35V probably benign Het
Cyp3a44 T C 5: 145,805,759 T11A probably benign Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Ghitm A T 14: 37,125,189 Y309* probably null Het
Klhl18 T C 9: 110,455,426 H64R probably damaging Het
Lpar3 T C 3: 146,241,163 F199L probably damaging Het
Mindy3 G A 2: 12,348,116 Q425* probably null Het
Olfr1468-ps1 A T 19: 13,375,613 Y217F unknown Het
P2rx7 A C 5: 122,664,550 N207T probably damaging Het
Pcdhb7 T G 18: 37,344,103 L764R probably benign Het
Sbf2 T C 7: 110,440,975 Y378C probably damaging Het
Slc23a2 C T 2: 132,078,481 S168N possibly damaging Het
Tmem260 A G 14: 48,496,456 probably null Het
Tmem8 G A 17: 26,121,564 V641I probably benign Het
Tmprss15 T G 16: 79,071,429 L198F probably benign Het
Tulp4 C T 17: 6,231,871 T725I possibly damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zcchc11 C A 4: 108,479,449 N123K probably benign Het
Zp3 A G 5: 135,987,498 D318G possibly damaging Het
Other mutations in Krt78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Krt78 APN 15 101947510 missense probably benign 0.28
IGL01358:Krt78 APN 15 101946263 missense probably benign 0.18
IGL01723:Krt78 APN 15 101951798 missense possibly damaging 0.65
IGL01743:Krt78 APN 15 101950898 missense probably benign 0.06
IGL01778:Krt78 APN 15 101950967 missense probably damaging 1.00
IGL01792:Krt78 APN 15 101946650 missense probably benign 0.01
IGL02271:Krt78 APN 15 101948593 missense probably benign 0.02
IGL02481:Krt78 APN 15 101948418 splice site probably benign
IGL02494:Krt78 APN 15 101954051 missense probably benign 0.00
IGL02708:Krt78 APN 15 101953407 missense possibly damaging 0.88
IGL02747:Krt78 APN 15 101950384 splice site probably benign
IGL02997:Krt78 APN 15 101947163 missense probably benign 0.11
IGL03350:Krt78 APN 15 101946517 missense probably benign 0.02
IGL03410:Krt78 APN 15 101953986 missense probably damaging 0.99
PIT4812001:Krt78 UTSW 15 101948069 missense probably damaging 1.00
R0090:Krt78 UTSW 15 101947837 missense probably benign 0.35
R0513:Krt78 UTSW 15 101950949 missense probably damaging 1.00
R0908:Krt78 UTSW 15 101950901 missense probably damaging 1.00
R1067:Krt78 UTSW 15 101946461 nonsense probably null
R1070:Krt78 UTSW 15 101946293 missense possibly damaging 0.86
R1194:Krt78 UTSW 15 101951786 missense probably damaging 0.99
R1213:Krt78 UTSW 15 101951810 missense probably benign 0.10
R1467:Krt78 UTSW 15 101946293 missense possibly damaging 0.86
R1467:Krt78 UTSW 15 101946293 missense possibly damaging 0.86
R1612:Krt78 UTSW 15 101951844 splice site probably null
R1750:Krt78 UTSW 15 101946377 missense probably benign 0.33
R1796:Krt78 UTSW 15 101950865 missense probably damaging 1.00
R1863:Krt78 UTSW 15 101946569 missense possibly damaging 0.53
R1901:Krt78 UTSW 15 101946963 nonsense probably null
R1902:Krt78 UTSW 15 101946963 nonsense probably null
R1975:Krt78 UTSW 15 101946168 makesense probably null
R2105:Krt78 UTSW 15 101947414 missense possibly damaging 0.93
R2418:Krt78 UTSW 15 101946634 missense probably benign
R2421:Krt78 UTSW 15 101947264 missense probably damaging 0.96
R2422:Krt78 UTSW 15 101947264 missense probably damaging 0.96
R2443:Krt78 UTSW 15 101946598 missense probably damaging 1.00
R2897:Krt78 UTSW 15 101947106 missense probably benign
R4422:Krt78 UTSW 15 101947940 missense probably benign 0.13
R4424:Krt78 UTSW 15 101947940 missense probably benign 0.13
R4425:Krt78 UTSW 15 101947940 missense probably benign 0.13
R4583:Krt78 UTSW 15 101946620 missense possibly damaging 0.53
R4752:Krt78 UTSW 15 101948202 missense probably benign 0.05
R4927:Krt78 UTSW 15 101946899 missense probably benign 0.02
R5129:Krt78 UTSW 15 101947580 missense possibly damaging 0.70
R5391:Krt78 UTSW 15 101951828 nonsense probably null
R5575:Krt78 UTSW 15 101947352 nonsense probably null
R5617:Krt78 UTSW 15 101947609 missense probably damaging 0.99
R5806:Krt78 UTSW 15 101950502 missense probably damaging 1.00
R5906:Krt78 UTSW 15 101948595 missense probably damaging 0.98
R5993:Krt78 UTSW 15 101950449 missense probably damaging 1.00
R6520:Krt78 UTSW 15 101951771 missense probably benign 0.26
R6531:Krt78 UTSW 15 101952273 missense probably benign 0.03
R6749:Krt78 UTSW 15 101950923 missense probably damaging 1.00
R7126:Krt78 UTSW 15 101948436 missense probably damaging 1.00
R7158:Krt78 UTSW 15 101951806 missense probably benign 0.17
R7229:Krt78 UTSW 15 101947394 missense probably benign 0.01
X0018:Krt78 UTSW 15 101951800 missense possibly damaging 0.96
Z1088:Krt78 UTSW 15 101947331 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GTCAAACAGCACTTCAGTCAGATC -3'
(R):5'- GTATAGAGAGGCCGTGTGAACC -3'

Sequencing Primer
(F):5'- GTAAATATCCCATCCTGTCAGAGGG -3'
(R):5'- GTGTGAACCCCCTAACAGG -3'
Posted On2018-06-22