Incidental Mutation 'R6587:Camkmt'
ID524480
Institutional Source Beutler Lab
Gene Symbol Camkmt
Ensembl Gene ENSMUSG00000071037
Gene Namecalmodulin-lysine N-methyltransferase
Synonyms1700106N22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6587 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location85090726-85458139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85113815 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 115 (V115A)
Ref Sequence ENSEMBL: ENSMUSP00000092811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095188]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095188
AA Change: V115A

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000092811
Gene: ENSMUSG00000071037
AA Change: V115A

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
Pfam:Methyltransf_16 110 278 7.7e-22 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class I protein methyltransferase that acts in the formation of trimethyllysine in calmodulin. The protein contains a AdoMet-binding motif and may play a role in calcium-dependent signaling. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight, reduced muscle strength and altered somatosensory development and brain function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc2 TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG 2: 25,272,538 probably benign Het
Ank3 G T 10: 69,990,152 probably benign Het
Ano3 C A 2: 110,797,904 probably null Het
Arhgap39 A G 15: 76,737,499 S301P probably damaging Het
Atad2 G T 15: 58,121,048 Q295K probably benign Het
Cenpf T C 1: 189,658,374 E1087G probably damaging Het
Cfhr2 T A 1: 139,810,858 I322F probably benign Het
Chil6 T C 3: 106,404,881 M35V probably benign Het
Cyp3a44 T C 5: 145,805,759 T11A probably benign Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Ghitm A T 14: 37,125,189 Y309* probably null Het
Klhl18 T C 9: 110,455,426 H64R probably damaging Het
Krt78 T C 15: 101,952,269 K201R probably benign Het
Lpar3 T C 3: 146,241,163 F199L probably damaging Het
Mindy3 G A 2: 12,348,116 Q425* probably null Het
Olfr1468-ps1 A T 19: 13,375,613 Y217F unknown Het
P2rx7 A C 5: 122,664,550 N207T probably damaging Het
Pcdhb7 T G 18: 37,344,103 L764R probably benign Het
Sbf2 T C 7: 110,440,975 Y378C probably damaging Het
Slc23a2 C T 2: 132,078,481 S168N possibly damaging Het
Tmem260 A G 14: 48,496,456 probably null Het
Tmem8 G A 17: 26,121,564 V641I probably benign Het
Tmprss15 T G 16: 79,071,429 L198F probably benign Het
Tulp4 C T 17: 6,231,871 T725I possibly damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zcchc11 C A 4: 108,479,449 N123K probably benign Het
Zp3 A G 5: 135,987,498 D318G possibly damaging Het
Other mutations in Camkmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Camkmt APN 17 85096666 splice site probably benign
IGL00786:Camkmt APN 17 85096491 missense probably damaging 0.99
IGL00840:Camkmt APN 17 85458123 nonsense probably null
IGL02604:Camkmt APN 17 85096625 missense possibly damaging 0.74
IGL02809:Camkmt APN 17 85394648 missense probably damaging 1.00
R0465:Camkmt UTSW 17 85431522 missense probably damaging 0.99
R0537:Camkmt UTSW 17 85394659 missense probably benign 0.01
R1573:Camkmt UTSW 17 85096530 missense probably damaging 0.98
R2442:Camkmt UTSW 17 85090775 missense possibly damaging 0.51
R2878:Camkmt UTSW 17 85431551 splice site probably benign
R5121:Camkmt UTSW 17 85096581 missense probably benign 0.00
R5174:Camkmt UTSW 17 85452237 missense probably benign
R6006:Camkmt UTSW 17 85452238 missense possibly damaging 0.71
R6726:Camkmt UTSW 17 85394609 missense probably damaging 0.98
R7301:Camkmt UTSW 17 85431493 missense probably benign 0.10
R7523:Camkmt UTSW 17 85391628 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGCAGACATTGTTTTAAAGCTG -3'
(R):5'- TGCATCTCCTATGGGGTACATTC -3'

Sequencing Primer
(F):5'- TAAAGCTGTAATACGGTGGGGCTC -3'
(R):5'- GGGTACATTCTACAGCTAAAGGTACC -3'
Posted On2018-06-22