Incidental Mutation 'R6622:Ptpa'
ID524490
Institutional Source Beutler Lab
Gene Symbol Ptpa
Ensembl Gene ENSMUSG00000039515
Gene Nameprotein phosphatase 2 protein activator
SynonymsPpp2r4, 2610042B21Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.903) question?
Stock #R6622 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location30416039-30447806 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 30437577 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 114 (E114D)
Ref Sequence ENSEMBL: ENSMUSP00000109233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042055] [ENSMUST00000113601] [ENSMUST00000113603] [ENSMUST00000131476]
Predicted Effect probably damaging
Transcript: ENSMUST00000042055
AA Change: E156D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046837
Gene: ENSMUSG00000039515
AA Change: E156D

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:PTPA 26 319 1.5e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113601
SMART Domains Protein: ENSMUSP00000109231
Gene: ENSMUSG00000039515

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:PTPA 38 104 5.7e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113603
AA Change: E114D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109233
Gene: ENSMUSG00000039515
AA Change: E114D

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:PTPA 64 280 5.7e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125561
SMART Domains Protein: ENSMUSP00000114290
Gene: ENSMUSG00000039515

DomainStartEndE-ValueType
Pfam:PTPA 1 125 6.1e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128516
Predicted Effect probably benign
Transcript: ENSMUST00000131476
SMART Domains Protein: ENSMUSP00000116268
Gene: ENSMUSG00000039515

DomainStartEndE-ValueType
Pfam:PTPA 1 61 8.3e-28 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase 2A is one of the four major Ser/Thr phosphatases and is implicated in the negative control of cell growth and division. Protein phosphatase 2A holoenzymes are heterotrimeric proteins composed of a structural subunit A, a catalytic subunit C, and a regulatory subunit B. The regulatory subunit is encoded by a diverse set of genes that have been grouped into the B/PR55, B'/PR61, and B''/PR72 families. These different regulatory subunits confer distinct enzymatic specificities and intracellular localizations to the holozenzyme. The product of this gene belongs to the B' family. This gene encodes a specific phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase 2A. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,244,222 A2563D probably damaging Het
6030419C18Rik A G 9: 58,499,250 I148V probably benign Het
Adgrl3 A C 5: 81,794,759 D1412A probably benign Het
Arhgap26 A G 18: 38,899,863 probably benign Het
Card14 A G 11: 119,333,988 M614V probably benign Het
Cbx2 A G 11: 119,029,135 T509A probably damaging Het
Cep135 A G 5: 76,640,968 D1136G probably benign Het
Cep170 T A 1: 176,756,332 Q827L probably damaging Het
Clock A T 5: 76,241,954 I349K probably damaging Het
Cnppd1 A T 1: 75,136,895 V243E probably damaging Het
Cops3 A G 11: 59,833,134 F93L probably damaging Het
Cxxc5 T G 18: 35,859,319 C258G possibly damaging Het
Cycs G A 6: 50,566,463 probably benign Het
Cyp2c40 A T 19: 39,802,546 H280Q probably damaging Het
Cyp4f14 C T 17: 32,914,645 R79H probably benign Het
Dnajc27 A G 12: 4,103,114 S197G probably benign Het
Dscam C T 16: 96,645,073 G1456E probably benign Het
Dst G A 1: 34,179,251 V1591I probably benign Het
Epha5 A G 5: 84,237,528 S315P possibly damaging Het
Fam46a G T 9: 85,326,456 R105S probably damaging Het
Frmd4a A G 2: 4,606,062 T1012A probably benign Het
Fxr2 G A 11: 69,641,590 probably null Het
Gm12394 T A 4: 42,793,111 L340F probably damaging Het
Hcn4 T A 9: 58,857,727 V534E unknown Het
Hrh4 A G 18: 13,022,397 Y331C probably damaging Het
Kif16b T A 2: 142,712,442 H812L probably benign Het
Krt14 T A 11: 100,203,960 R451S probably benign Het
Man2b1 A G 8: 85,084,479 T80A probably damaging Het
Nedd4l A G 18: 65,174,234 T383A probably damaging Het
Pcdha9 T A 18: 36,998,654 L259M possibly damaging Het
Pdgfd T C 9: 6,293,818 C131R probably damaging Het
Prrc2a C G 17: 35,155,420 R1418P probably damaging Het
Ptprt A T 2: 161,553,840 C1157S probably damaging Het
Rnf126 A T 10: 79,761,563 probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Sel1l3 A G 5: 53,139,860 V748A probably damaging Het
Serinc5 T A 13: 92,688,686 S208T probably benign Het
Sftpb A G 6: 72,305,655 I74V possibly damaging Het
Slc22a14 A C 9: 119,170,577 I516S possibly damaging Het
Slco2a1 G A 9: 103,074,505 C411Y possibly damaging Het
Tet3 G A 6: 83,403,444 P581S probably benign Het
Tmem231 T C 8: 111,918,931 D112G probably damaging Het
Tnrc6b T A 15: 80,879,184 W296R probably damaging Het
Trpm1 T A 7: 64,240,595 L982H probably damaging Het
Ttn C A 2: 76,720,518 R23183I possibly damaging Het
Tuft1 T A 3: 94,635,419 Y46F probably damaging Het
Vmn1r167 T A 7: 23,505,589 M1L probably null Het
Zfp808 A G 13: 62,171,832 R292G possibly damaging Het
Zp2 T C 7: 120,132,525 E669G probably benign Het
Zp2 C T 7: 120,141,913 M129I probably benign Het
Other mutations in Ptpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02066:Ptpa APN 2 30443296 missense possibly damaging 0.83
IGL02073:Ptpa APN 2 30443350 missense probably damaging 1.00
IGL02201:Ptpa APN 2 30446377 missense possibly damaging 0.91
R1602:Ptpa UTSW 2 30437590 missense probably benign 0.22
R3962:Ptpa UTSW 2 30435660 missense probably damaging 1.00
R4080:Ptpa UTSW 2 30443305 missense probably damaging 1.00
R5186:Ptpa UTSW 2 30438355 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGGGTTTCTAATTGGTCAAACC -3'
(R):5'- TAAATTAGCCTCAGAACAGCGC -3'

Sequencing Primer
(F):5'- TTGGTCAAACCCATAAAGTAAGGTGC -3'
(R):5'- CAGCGCCTGTATGTGATGAAC -3'
Posted On2018-06-22