Incidental Mutation 'R6622:Cep135'
ID524507
Institutional Source Beutler Lab
Gene Symbol Cep135
Ensembl Gene ENSMUSG00000036403
Gene Namecentrosomal protein 135
SynonymsLOC381644, Cep4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6622 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location76588698-76646466 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76640968 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1136 (D1136G)
Ref Sequence ENSEMBL: ENSMUSP00000112602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049060] [ENSMUST00000121979]
Predicted Effect probably benign
Transcript: ENSMUST00000049060
AA Change: D1136G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000038674
Gene: ENSMUSG00000036403
AA Change: D1136G

DomainStartEndE-ValueType
internal_repeat_1 47 71 1.87e-5 PROSPERO
low complexity region 78 92 N/A INTRINSIC
internal_repeat_1 100 124 1.87e-5 PROSPERO
coiled coil region 125 153 N/A INTRINSIC
coiled coil region 194 245 N/A INTRINSIC
coiled coil region 267 420 N/A INTRINSIC
coiled coil region 445 470 N/A INTRINSIC
Blast:HAMP 492 527 5e-11 BLAST
Blast:SPEC 760 863 6e-21 BLAST
low complexity region 1060 1072 N/A INTRINSIC
coiled coil region 1075 1117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121979
AA Change: D1136G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000112602
Gene: ENSMUSG00000036403
AA Change: D1136G

DomainStartEndE-ValueType
internal_repeat_1 47 71 1.87e-5 PROSPERO
low complexity region 78 92 N/A INTRINSIC
internal_repeat_1 100 124 1.87e-5 PROSPERO
coiled coil region 125 153 N/A INTRINSIC
coiled coil region 194 245 N/A INTRINSIC
coiled coil region 267 420 N/A INTRINSIC
coiled coil region 445 470 N/A INTRINSIC
Blast:HAMP 492 527 5e-11 BLAST
Blast:SPEC 760 863 6e-21 BLAST
low complexity region 1060 1072 N/A INTRINSIC
coiled coil region 1075 1117 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130651
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein, which acts as a scaffolding protein during early centriole biogenesis, and is also required for centriole-centriole cohesion during interphase. Mutations in this gene are associated with autosomal recessive primary microcephaly-8. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,244,222 A2563D probably damaging Het
6030419C18Rik A G 9: 58,499,250 I148V probably benign Het
Adgrl3 A C 5: 81,794,759 D1412A probably benign Het
Arhgap26 A G 18: 38,899,863 probably benign Het
Card14 A G 11: 119,333,988 M614V probably benign Het
Cbx2 A G 11: 119,029,135 T509A probably damaging Het
Cep170 T A 1: 176,756,332 Q827L probably damaging Het
Clock A T 5: 76,241,954 I349K probably damaging Het
Cnppd1 A T 1: 75,136,895 V243E probably damaging Het
Cops3 A G 11: 59,833,134 F93L probably damaging Het
Cxxc5 T G 18: 35,859,319 C258G possibly damaging Het
Cycs G A 6: 50,566,463 probably benign Het
Cyp2c40 A T 19: 39,802,546 H280Q probably damaging Het
Cyp4f14 C T 17: 32,914,645 R79H probably benign Het
Dnajc27 A G 12: 4,103,114 S197G probably benign Het
Dscam C T 16: 96,645,073 G1456E probably benign Het
Dst G A 1: 34,179,251 V1591I probably benign Het
Epha5 A G 5: 84,237,528 S315P possibly damaging Het
Fam46a G T 9: 85,326,456 R105S probably damaging Het
Frmd4a A G 2: 4,606,062 T1012A probably benign Het
Fxr2 G A 11: 69,641,590 probably null Het
Gm12394 T A 4: 42,793,111 L340F probably damaging Het
Hcn4 T A 9: 58,857,727 V534E unknown Het
Hrh4 A G 18: 13,022,397 Y331C probably damaging Het
Kif16b T A 2: 142,712,442 H812L probably benign Het
Krt14 T A 11: 100,203,960 R451S probably benign Het
Man2b1 A G 8: 85,084,479 T80A probably damaging Het
Nedd4l A G 18: 65,174,234 T383A probably damaging Het
Pcdha9 T A 18: 36,998,654 L259M possibly damaging Het
Pdgfd T C 9: 6,293,818 C131R probably damaging Het
Prrc2a C G 17: 35,155,420 R1418P probably damaging Het
Ptpa G T 2: 30,437,577 E114D probably damaging Het
Ptprt A T 2: 161,553,840 C1157S probably damaging Het
Rnf126 A T 10: 79,761,563 probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Sel1l3 A G 5: 53,139,860 V748A probably damaging Het
Serinc5 T A 13: 92,688,686 S208T probably benign Het
Sftpb A G 6: 72,305,655 I74V possibly damaging Het
Slc22a14 A C 9: 119,170,577 I516S possibly damaging Het
Slco2a1 G A 9: 103,074,505 C411Y possibly damaging Het
Tet3 G A 6: 83,403,444 P581S probably benign Het
Tmem231 T C 8: 111,918,931 D112G probably damaging Het
Tnrc6b T A 15: 80,879,184 W296R probably damaging Het
Trpm1 T A 7: 64,240,595 L982H probably damaging Het
Ttn C A 2: 76,720,518 R23183I possibly damaging Het
Tuft1 T A 3: 94,635,419 Y46F probably damaging Het
Vmn1r167 T A 7: 23,505,589 M1L probably null Het
Zfp808 A G 13: 62,171,832 R292G possibly damaging Het
Zp2 T C 7: 120,132,525 E669G probably benign Het
Zp2 C T 7: 120,141,913 M129I probably benign Het
Other mutations in Cep135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Cep135 APN 5 76601459 missense probably damaging 0.98
IGL01154:Cep135 APN 5 76606796 splice site probably benign
IGL01323:Cep135 APN 5 76591765 missense probably benign 0.29
IGL01599:Cep135 APN 5 76593347 missense possibly damaging 0.93
IGL01923:Cep135 APN 5 76640982 makesense probably null
IGL02178:Cep135 APN 5 76595474 missense probably damaging 1.00
IGL02276:Cep135 APN 5 76634246 missense probably benign 0.00
IGL02344:Cep135 APN 5 76616821 missense probably benign
IGL02394:Cep135 APN 5 76631471 missense probably benign 0.02
IGL02740:Cep135 APN 5 76638268 critical splice donor site probably null
IGL02832:Cep135 APN 5 76640949 missense probably damaging 0.98
R0026:Cep135 UTSW 5 76606734 nonsense probably null
R0060:Cep135 UTSW 5 76621350 missense probably benign 0.20
R0325:Cep135 UTSW 5 76615743 missense probably damaging 0.98
R0336:Cep135 UTSW 5 76601502 missense probably benign 0.07
R0564:Cep135 UTSW 5 76615710 missense probably damaging 1.00
R0564:Cep135 UTSW 5 76638949 missense probably benign 0.03
R0600:Cep135 UTSW 5 76621305 missense probably benign
R0636:Cep135 UTSW 5 76615657 missense probably benign 0.07
R0704:Cep135 UTSW 5 76630949 missense possibly damaging 0.62
R0835:Cep135 UTSW 5 76615706 missense probably benign 0.40
R1015:Cep135 UTSW 5 76640997 critical splice donor site probably null
R1167:Cep135 UTSW 5 76624637 missense probably damaging 1.00
R1252:Cep135 UTSW 5 76594115 missense possibly damaging 0.67
R1554:Cep135 UTSW 5 76634213 nonsense probably null
R1770:Cep135 UTSW 5 76603195 missense possibly damaging 0.95
R1804:Cep135 UTSW 5 76636932 missense probably benign 0.22
R1968:Cep135 UTSW 5 76624747 missense possibly damaging 0.96
R1987:Cep135 UTSW 5 76597428 missense probably benign 0.00
R1996:Cep135 UTSW 5 76632266 missense probably benign 0.08
R2004:Cep135 UTSW 5 76632329 critical splice donor site probably null
R2178:Cep135 UTSW 5 76631450 missense probably benign 0.00
R2305:Cep135 UTSW 5 76595389 splice site probably benign
R2679:Cep135 UTSW 5 76624660 missense probably benign
R3125:Cep135 UTSW 5 76621363 critical splice donor site probably null
R3623:Cep135 UTSW 5 76624739 missense probably benign 0.00
R4359:Cep135 UTSW 5 76611714 missense possibly damaging 0.47
R4407:Cep135 UTSW 5 76624667 missense probably benign
R4561:Cep135 UTSW 5 76638193 missense possibly damaging 0.95
R4666:Cep135 UTSW 5 76616854 missense probably benign
R4945:Cep135 UTSW 5 76597428 missense probably benign 0.00
R5105:Cep135 UTSW 5 76594092 missense probably benign 0.00
R5117:Cep135 UTSW 5 76631429 missense probably benign 0.01
R5176:Cep135 UTSW 5 76637026 missense probably benign 0.04
R5194:Cep135 UTSW 5 76615777 missense probably benign 0.05
R5233:Cep135 UTSW 5 76591843 small deletion probably benign
R5275:Cep135 UTSW 5 76593204 missense possibly damaging 0.94
R5295:Cep135 UTSW 5 76593204 missense possibly damaging 0.94
R5412:Cep135 UTSW 5 76616862 missense probably benign 0.00
R5427:Cep135 UTSW 5 76638202 missense probably benign 0.00
R5801:Cep135 UTSW 5 76630676 missense probably damaging 1.00
R5975:Cep135 UTSW 5 76640890 missense possibly damaging 0.94
R6087:Cep135 UTSW 5 76615791 critical splice donor site probably null
R6176:Cep135 UTSW 5 76624643 missense probably benign
R6210:Cep135 UTSW 5 76624723 missense probably benign 0.15
R6456:Cep135 UTSW 5 76591724 start gained probably benign
R6467:Cep135 UTSW 5 76621340 missense possibly damaging 0.50
R6650:Cep135 UTSW 5 76633701 missense possibly damaging 0.77
R6838:Cep135 UTSW 5 76632215 missense probably damaging 1.00
R7028:Cep135 UTSW 5 76616848 missense probably benign
R7049:Cep135 UTSW 5 76606738 missense probably benign 0.01
R7095:Cep135 UTSW 5 76594058 missense probably benign 0.10
R7207:Cep135 UTSW 5 76632243 missense probably benign 0.00
R7330:Cep135 UTSW 5 76606745 nonsense probably null
R7369:Cep135 UTSW 5 76593253 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCACTAGCAGGTGTTCTGTAG -3'
(R):5'- CACAGTGAAATGCAGAGCAC -3'

Sequencing Primer
(F):5'- GTGTTCTGTAGTGGACTAATAACCCC -3'
(R):5'- TGTGACTATGACATGCCACC -3'
Posted On2018-06-22