Incidental Mutation 'R6591:Pld3'
ID524574
Institutional Source Beutler Lab
Gene Symbol Pld3
Ensembl Gene ENSMUSG00000003363
Gene Namephospholipase D family, member 3
SynonymsSam-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6591 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location27532000-27553218 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27532316 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 483 (N483K)
Ref Sequence ENSEMBL: ENSMUSP00000112942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037134] [ENSMUST00000108353] [ENSMUST00000117095] [ENSMUST00000117611]
Predicted Effect probably benign
Transcript: ENSMUST00000037134
SMART Domains Protein: ENSMUSP00000043175
Gene: ENSMUSG00000040424

DomainStartEndE-ValueType
SCOP:d1howa_ 1 142 8e-12 SMART
Blast:S_TKc 1 143 8e-99 BLAST
PDB:3ANR|D 1 155 1e-12 PDB
low complexity region 192 206 N/A INTRINSIC
low complexity region 389 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108353
SMART Domains Protein: ENSMUSP00000103990
Gene: ENSMUSG00000040424

DomainStartEndE-ValueType
S_TKc 11 347 9.31e-74 SMART
low complexity region 396 410 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117095
AA Change: N483K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113820
Gene: ENSMUSG00000003363
AA Change: N483K

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
PLDc 194 221 9.25e-10 SMART
Pfam:PLDc_3 224 401 1.6e-43 PFAM
PLDc 409 435 1.19e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117611
AA Change: N483K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000112942
Gene: ENSMUSG00000003363
AA Change: N483K

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
PLDc 194 221 9.25e-10 SMART
low complexity region 285 297 N/A INTRINSIC
PLDc 409 435 1.19e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155287
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phospholipase D (PLD) family of enzymes that catalyze the hydrolysis of membrane phospholipids. The encoded protein is a single-pass type II membrane protein and contains two PLD phosphodiesterase domains. This protein influences processing of amyloid-beta precursor protein. Mutations in this gene are associated with Alzheimer disease risk. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300009A05Rik A G 9: 63,398,954 Y90H probably damaging Het
Agk A G 6: 40,392,690 D337G probably benign Het
Amn A G 12: 111,275,397 H299R possibly damaging Het
Angptl4 A G 17: 33,780,781 probably null Het
AU040320 G A 4: 126,836,670 M563I possibly damaging Het
Cachd1 T C 4: 100,989,486 M1042T probably benign Het
Cd209c T A 8: 3,945,680 I41L probably benign Het
Ceacam12 T A 7: 18,069,224 V185D possibly damaging Het
Chpt1 A T 10: 88,485,900 probably benign Het
Clca1 G C 3: 145,013,883 A442G probably damaging Het
Cldn8 T C 16: 88,562,535 I167M possibly damaging Het
Cln3 A G 7: 126,579,434 V143A possibly damaging Het
Dusp11 T C 6: 85,961,525 H4R possibly damaging Het
Ephb3 T A 16: 21,214,473 F69Y probably damaging Het
Gm11099 A T 2: 58,859,473 probably benign Het
Grik2 A T 10: 49,272,925 Y521* probably null Het
Igf2r A G 17: 12,689,008 L2143P probably damaging Het
Kcnk1 T C 8: 126,025,231 V192A probably benign Het
Olfr1055 A C 2: 86,347,419 S116A probably damaging Het
Olfr1254 A T 2: 89,788,988 Y121* probably null Het
Parp3 A G 9: 106,473,692 S329P probably benign Het
Rbm33 A T 5: 28,352,546 E252D probably damaging Het
Ryr2 T C 13: 11,594,723 T4406A probably benign Het
Sgsm3 A G 15: 81,008,862 D380G possibly damaging Het
Sorl1 G T 9: 42,002,567 D1355E probably damaging Het
Sptbn1 A G 11: 30,113,984 S1945P probably damaging Het
Ube2m A T 7: 13,036,469 F70I probably damaging Het
Ube3b A G 5: 114,408,124 I664V probably benign Het
Ugt1a7c A G 1: 88,095,656 E179G possibly damaging Het
Vps50 T C 6: 3,504,939 probably null Het
Xpo1 T C 11: 23,286,875 L718P probably damaging Het
Zfp354c A G 11: 50,814,775 I491T probably benign Het
Other mutations in Pld3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Pld3 APN 7 27532619 missense probably damaging 1.00
R0624:Pld3 UTSW 7 27539575 missense possibly damaging 0.94
R1384:Pld3 UTSW 7 27537657 missense probably benign 0.00
R1845:Pld3 UTSW 7 27539452 missense probably benign 0.01
R2235:Pld3 UTSW 7 27541107 missense probably benign 0.00
R3106:Pld3 UTSW 7 27535787 critical splice donor site probably null
R5141:Pld3 UTSW 7 27533795 missense probably damaging 1.00
R5486:Pld3 UTSW 7 27533731 missense probably damaging 0.99
R5518:Pld3 UTSW 7 27532371 missense probably damaging 1.00
R5868:Pld3 UTSW 7 27537668 missense probably benign 0.00
R6446:Pld3 UTSW 7 27537731 missense probably damaging 1.00
R6691:Pld3 UTSW 7 27532316 missense probably benign 0.00
R6823:Pld3 UTSW 7 27535897 missense probably damaging 1.00
R7162:Pld3 UTSW 7 27532474 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACTCAGTTAAGCACAGG -3'
(R):5'- ACCTCCAACTGGTCTGGAAG -3'

Sequencing Primer
(F):5'- AATCCCCAGCTCTGCTAGG -3'
(R):5'- AACTGGTCTGGAAGCTACTTCACG -3'
Posted On2018-06-22