Incidental Mutation 'R6623:Igkv10-96'
ID524599
Institutional Source Beutler Lab
Gene Symbol Igkv10-96
Ensembl Gene ENSMUSG00000094420
Gene Nameimmunoglobulin kappa variable 10-96
SynonymsGm16637
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #R6623 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location68631965-68632430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 68632174 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 46 (S46R)
Ref Sequence ENSEMBL: ENSMUSP00000100129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103328]
Predicted Effect probably damaging
Transcript: ENSMUST00000103328
AA Change: S46R

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000100129
Gene: ENSMUSG00000094420
AA Change: S46R

DomainStartEndE-ValueType
low complexity region 8 13 N/A INTRINSIC
IGv 38 110 1.94e-19 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik A T 2: 148,850,762 I40K probably benign Het
Abcc10 T C 17: 46,323,462 K460E probably damaging Het
Acaca A C 11: 84,371,499 probably null Het
Adamts1 A G 16: 85,795,637 S628P probably benign Het
Ankrd13a A G 5: 114,786,757 N101S probably benign Het
Asic5 G A 3: 82,008,585 V281M probably damaging Het
Atxn7 T C 14: 14,099,972 S553P probably damaging Het
Fndc3c1 G C X: 106,435,073 L724V possibly damaging Homo
Hmcn1 A G 1: 150,758,306 F843S probably benign Het
Itfg2 G T 6: 128,411,657 A289D probably damaging Het
Klc1 C A 12: 111,806,041 N597K probably damaging Het
Lnx2 A G 5: 147,024,487 V545A probably damaging Het
Map3k11 A G 19: 5,695,603 I344V probably damaging Het
Muc6 G A 7: 141,639,559 probably benign Het
Myrf C A 19: 10,223,359 A317S probably benign Het
Ncoa2 A T 1: 13,181,297 C251S probably damaging Het
Olfr556 T G 7: 102,670,034 M38R possibly damaging Het
Pcdhb12 C T 18: 37,437,658 T619I possibly damaging Het
Plxna1 A T 6: 89,322,771 M1672K probably damaging Het
Prl G T 13: 27,061,509 V72L probably benign Het
Prokr2 G T 2: 132,373,574 N161K probably damaging Het
Ryr2 T C 13: 11,710,065 D2454G probably damaging Het
Slc2a12 T A 10: 22,664,900 M218K probably damaging Het
Sorcs3 C T 19: 48,788,505 A992V probably benign Het
Stxbp2 T C 8: 3,632,561 I50T probably damaging Het
Supt20 A G 3: 54,718,294 I570M possibly damaging Het
Sv2b T A 7: 75,206,384 I53F probably damaging Het
Vmn1r113 T A 7: 20,788,066 M261K probably benign Het
Vmn1r217 T A 13: 23,114,676 I19F possibly damaging Het
Vmn2r45 T C 7: 8,471,501 T843A probably benign Het
Vmn2r69 T A 7: 85,407,101 I610L possibly damaging Het
Other mutations in Igkv10-96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Igkv10-96 APN 6 68632102 missense probably benign 0.04
R1555:Igkv10-96 UTSW 6 68632381 critical splice donor site probably benign
R4347:Igkv10-96 UTSW 6 68632180 missense probably benign 0.10
R5229:Igkv10-96 UTSW 6 68632239 missense possibly damaging 0.88
R6396:Igkv10-96 UTSW 6 68631985 nonsense probably null
R7183:Igkv10-96 UTSW 6 68632216 missense probably benign 0.39
R7194:Igkv10-96 UTSW 6 68632044 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GGAAGCGTATTACCCTGTTGG -3'
(R):5'- ACAATGGGAATTTTGCTGTTGC -3'

Sequencing Primer
(F):5'- GCGTATTACCCTGTTGGCAAAAG -3'
(R):5'- TGCACAGTGATTCTTGTTGAC -3'
Posted On2018-06-22