Incidental Mutation 'R6623:Vmn2r69'
ID524609
Institutional Source Beutler Lab
Gene Symbol Vmn2r69
Ensembl Gene ENSMUSG00000091006
Gene Namevomeronasal 2, receptor 69
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6623 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location85404849-85417476 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85407101 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 610 (I610L)
Ref Sequence ENSEMBL: ENSMUSP00000132726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171213]
Predicted Effect possibly damaging
Transcript: ENSMUST00000171213
AA Change: I610L

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132726
Gene: ENSMUSG00000091006
AA Change: I610L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 465 1.3e-28 PFAM
Pfam:NCD3G 507 559 1.8e-20 PFAM
Pfam:7tm_3 592 827 3.2e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207880
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik A T 2: 148,850,762 I40K probably benign Het
Abcc10 T C 17: 46,323,462 K460E probably damaging Het
Acaca A C 11: 84,371,499 probably null Het
Adamts1 A G 16: 85,795,637 S628P probably benign Het
Ankrd13a A G 5: 114,786,757 N101S probably benign Het
Asic5 G A 3: 82,008,585 V281M probably damaging Het
Atxn7 T C 14: 14,099,972 S553P probably damaging Het
Fndc3c1 G C X: 106,435,073 L724V possibly damaging Homo
Hmcn1 A G 1: 150,758,306 F843S probably benign Het
Igkv10-96 T G 6: 68,632,174 S46R probably damaging Het
Itfg2 G T 6: 128,411,657 A289D probably damaging Het
Klc1 C A 12: 111,806,041 N597K probably damaging Het
Lnx2 A G 5: 147,024,487 V545A probably damaging Het
Map3k11 A G 19: 5,695,603 I344V probably damaging Het
Muc6 G A 7: 141,639,559 probably benign Het
Myrf C A 19: 10,223,359 A317S probably benign Het
Ncoa2 A T 1: 13,181,297 C251S probably damaging Het
Olfr556 T G 7: 102,670,034 M38R possibly damaging Het
Pcdhb12 C T 18: 37,437,658 T619I possibly damaging Het
Plxna1 A T 6: 89,322,771 M1672K probably damaging Het
Prl G T 13: 27,061,509 V72L probably benign Het
Prokr2 G T 2: 132,373,574 N161K probably damaging Het
Ryr2 T C 13: 11,710,065 D2454G probably damaging Het
Slc2a12 T A 10: 22,664,900 M218K probably damaging Het
Sorcs3 C T 19: 48,788,505 A992V probably benign Het
Stxbp2 T C 8: 3,632,561 I50T probably damaging Het
Supt20 A G 3: 54,718,294 I570M possibly damaging Het
Sv2b T A 7: 75,206,384 I53F probably damaging Het
Vmn1r113 T A 7: 20,788,066 M261K probably benign Het
Vmn1r217 T A 13: 23,114,676 I19F possibly damaging Het
Vmn2r45 T C 7: 8,471,501 T843A probably benign Het
Other mutations in Vmn2r69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Vmn2r69 APN 7 85406531 missense probably benign
IGL01457:Vmn2r69 APN 7 85406628 missense possibly damaging 0.87
IGL01760:Vmn2r69 APN 7 85406864 missense possibly damaging 0.90
IGL01834:Vmn2r69 APN 7 85412368 missense probably damaging 1.00
IGL02001:Vmn2r69 APN 7 85407226 missense probably benign 0.05
IGL02057:Vmn2r69 APN 7 85411782 missense possibly damaging 0.93
IGL02289:Vmn2r69 APN 7 85406846 missense probably damaging 1.00
IGL02472:Vmn2r69 APN 7 85409752 missense probably benign 0.01
IGL02478:Vmn2r69 APN 7 85406681 missense probably damaging 1.00
IGL02554:Vmn2r69 APN 7 85409806 missense probably damaging 1.00
IGL02723:Vmn2r69 APN 7 85410208 missense probably damaging 1.00
R0526:Vmn2r69 UTSW 7 85411503 missense probably damaging 1.00
R0560:Vmn2r69 UTSW 7 85409714 critical splice donor site probably null
R0909:Vmn2r69 UTSW 7 85406665 missense probably benign 0.00
R0976:Vmn2r69 UTSW 7 85406900 missense probably damaging 1.00
R1158:Vmn2r69 UTSW 7 85409850 splice site probably benign
R1459:Vmn2r69 UTSW 7 85406700 nonsense probably null
R1482:Vmn2r69 UTSW 7 85406874 missense probably damaging 1.00
R1917:Vmn2r69 UTSW 7 85411683 missense probably damaging 1.00
R2016:Vmn2r69 UTSW 7 85407285 missense probably damaging 0.98
R2108:Vmn2r69 UTSW 7 85410196 missense probably benign
R2571:Vmn2r69 UTSW 7 85415556 missense probably benign
R2910:Vmn2r69 UTSW 7 85406710 missense probably damaging 1.00
R2920:Vmn2r69 UTSW 7 85411765 missense probably benign 0.08
R3708:Vmn2r69 UTSW 7 85411821 missense probably damaging 0.98
R3710:Vmn2r69 UTSW 7 85406393 missense probably benign
R4757:Vmn2r69 UTSW 7 85412367 missense probably damaging 0.99
R4823:Vmn2r69 UTSW 7 85411300 missense probably benign 0.21
R4870:Vmn2r69 UTSW 7 85411585 missense possibly damaging 0.93
R4918:Vmn2r69 UTSW 7 85406759 missense probably benign 0.06
R5022:Vmn2r69 UTSW 7 85411159 missense possibly damaging 0.72
R5174:Vmn2r69 UTSW 7 85415531 missense possibly damaging 0.92
R5200:Vmn2r69 UTSW 7 85406509 missense probably damaging 1.00
R5278:Vmn2r69 UTSW 7 85411783 missense probably benign 0.02
R5643:Vmn2r69 UTSW 7 85407196 missense probably damaging 0.98
R5996:Vmn2r69 UTSW 7 85411909 splice site probably null
R6083:Vmn2r69 UTSW 7 85406503 missense probably damaging 1.00
R6140:Vmn2r69 UTSW 7 85411449 missense probably damaging 0.99
R6306:Vmn2r69 UTSW 7 85415591 missense probably benign 0.04
R6330:Vmn2r69 UTSW 7 85411627 missense probably benign
R6380:Vmn2r69 UTSW 7 85411859 missense probably benign
R6466:Vmn2r69 UTSW 7 85407170 missense probably benign 0.01
R6542:Vmn2r69 UTSW 7 85411205 nonsense probably null
R6583:Vmn2r69 UTSW 7 85409809 missense probably benign
R6709:Vmn2r69 UTSW 7 85411861 missense probably benign 0.03
R6732:Vmn2r69 UTSW 7 85411143 missense probably benign 0.00
R6741:Vmn2r69 UTSW 7 85412516 missense probably benign 0.01
R7070:Vmn2r69 UTSW 7 85411480 missense probably damaging 0.98
R7234:Vmn2r69 UTSW 7 85407107 missense probably benign 0.22
R7323:Vmn2r69 UTSW 7 85411764 missense possibly damaging 0.95
R7427:Vmn2r69 UTSW 7 85411259 missense probably benign 0.28
R7428:Vmn2r69 UTSW 7 85411259 missense probably benign 0.28
R7453:Vmn2r69 UTSW 7 85411560 frame shift probably null
R7532:Vmn2r69 UTSW 7 85410414 missense not run
R7556:Vmn2r69 UTSW 7 85411560 frame shift probably null
R7562:Vmn2r69 UTSW 7 85407212 missense not run
Predicted Primers PCR Primer
(F):5'- TATTTGGGTGCCCCTGACAC -3'
(R):5'- GTGTCTGGAAGATCAATATGCCAATG -3'

Sequencing Primer
(F):5'- GGAACAGTTATCTTGAATGCCAG -3'
(R):5'- TATGCCAATGAAGACCATACTCTCTG -3'
Posted On2018-06-22