Incidental Mutation 'R6592:Tlk1'
ID524614
Institutional Source Beutler Lab
Gene Symbol Tlk1
Ensembl Gene ENSMUSG00000041997
Gene Nametousled-like kinase 1
Synonyms4930545J15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6592 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location70712407-70825728 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70714153 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 713 (R713C)
Ref Sequence ENSEMBL: ENSMUSP00000035961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038584] [ENSMUST00000133432]
Predicted Effect probably damaging
Transcript: ENSMUST00000038584
AA Change: R713C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035961
Gene: ENSMUSG00000041997
AA Change: R713C

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
low complexity region 68 85 N/A INTRINSIC
low complexity region 170 192 N/A INTRINSIC
coiled coil region 248 277 N/A INTRINSIC
coiled coil region 403 441 N/A INTRINSIC
S_TKc 456 734 4.41e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133432
SMART Domains Protein: ENSMUSP00000121549
Gene: ENSMUSG00000014959

DomainStartEndE-ValueType
PDZ 5 75 8.14e-1 SMART
internal_repeat_1 107 196 1.1e-15 PROSPERO
low complexity region 236 252 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141707
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152738
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 94% (31/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase that may be involved in the regulation of chromatin assembly. The encoded protein is only active when it is phosphorylated, and this phosphorylation is cell cycle-dependent, with the maximal activity of this protein coming during S phase. The catalytic activity of this protein is diminished by DNA damage and by blockage of DNA replication. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 107,023,718 V340A possibly damaging Het
Btbd17 T C 11: 114,791,476 Y470C probably damaging Het
Clca1 G C 3: 145,013,883 A442G probably damaging Het
Cyp4v3 A T 8: 45,306,981 N511K probably benign Het
Efcab5 G T 11: 77,113,610 Q1097K possibly damaging Het
Epha7 T C 4: 28,813,482 probably null Het
Exoc6 A G 19: 37,571,912 T126A probably benign Het
Fnip2 T C 3: 79,481,708 Q572R probably benign Het
Gm17430 C T 18: 9,726,514 V53I probably benign Het
Gpr149 T C 3: 62,530,540 D732G probably benign Het
Hdlbp A G 1: 93,412,361 probably null Het
Herc2 A G 7: 56,207,690 probably null Het
Htt C T 5: 34,877,044 T1953I possibly damaging Het
Lgmn C T 12: 102,404,270 V134I probably damaging Het
Lysmd1 A G 3: 95,137,886 S148G probably benign Het
Man2a2 T C 7: 80,353,199 D1054G probably damaging Het
Mcph1 A G 8: 18,668,967 T640A probably damaging Het
Nat10 T C 2: 103,754,150 E94G probably null Het
Olfr110 T A 17: 37,499,097 W149R probably damaging Het
Olfr1200 G A 2: 88,768,127 H63Y probably damaging Het
Pgm3 A G 9: 86,559,443 V367A possibly damaging Het
Ppp1r1a A C 15: 103,531,372 D164E probably damaging Het
Proca1 G T 11: 78,204,953 S137I probably benign Het
Serinc5 T C 13: 92,708,126 F459L possibly damaging Het
Slc12a8 T C 16: 33,617,256 probably null Het
Slc51a T C 16: 32,475,803 D321G probably damaging Het
Tchhl1 T A 3: 93,470,809 D273E probably damaging Het
Tmem211 A G 5: 113,234,463 Y34C probably damaging Het
Tpr T C 1: 150,411,905 I465T possibly damaging Het
Usp1 A G 4: 98,926,519 I5M possibly damaging Het
Zcchc14 T C 8: 121,604,639 probably benign Het
Other mutations in Tlk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Tlk1 APN 2 70745516 missense probably damaging 1.00
IGL01087:Tlk1 APN 2 70752316 missense possibly damaging 0.64
IGL01514:Tlk1 APN 2 70752266 missense probably benign 0.00
IGL02976:Tlk1 APN 2 70721591 nonsense probably null
IGL03024:Tlk1 APN 2 70746036 nonsense probably null
aku-aku UTSW 2 70738445 missense probably damaging 0.98
Heyerdahl UTSW 2 70738426 nonsense probably null
K3955:Tlk1 UTSW 2 70721701 missense possibly damaging 0.85
R0107:Tlk1 UTSW 2 70713989 makesense probably null
R0226:Tlk1 UTSW 2 70714169 unclassified probably benign
R0332:Tlk1 UTSW 2 70745565 synonymous probably null
R0601:Tlk1 UTSW 2 70714158 missense probably benign 0.44
R1739:Tlk1 UTSW 2 70721077 missense probably damaging 1.00
R2080:Tlk1 UTSW 2 70738445 missense probably damaging 0.98
R2422:Tlk1 UTSW 2 70770005 missense probably damaging 1.00
R3843:Tlk1 UTSW 2 70749327 missense probably benign 0.05
R3970:Tlk1 UTSW 2 70716652 missense probably damaging 1.00
R4191:Tlk1 UTSW 2 70725547 missense probably damaging 1.00
R4867:Tlk1 UTSW 2 70721571 nonsense probably null
R5022:Tlk1 UTSW 2 70742065 missense probably benign 0.10
R5275:Tlk1 UTSW 2 70752205 intron probably benign
R5469:Tlk1 UTSW 2 70721668 missense probably benign 0.15
R6531:Tlk1 UTSW 2 70742083 missense probably benign 0.00
R6797:Tlk1 UTSW 2 70738426 nonsense probably null
R7030:Tlk1 UTSW 2 70721928 missense probably damaging 1.00
X0028:Tlk1 UTSW 2 70746031 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATGCCAATCTTAGAGGAGTCAG -3'
(R):5'- TTGAGCCTATGATGTGCCCG -3'

Sequencing Primer
(F):5'- GAGGAGTCAGTAAGTAATTATGCTTG -3'
(R):5'- CCACTGGAGGGTTGCAATTG -3'
Posted On2018-06-22