Incidental Mutation 'R6592:Olfr1200'
ID524616
Institutional Source Beutler Lab
Gene Symbol Olfr1200
Ensembl Gene ENSMUSG00000075115
Gene Nameolfactory receptor 1200
SynonymsMOR225-12, GA_x6K02T2Q125-50243231-50242221
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6592 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88763511-88770488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88768127 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 63 (H63Y)
Ref Sequence ENSEMBL: ENSMUSP00000149757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099811] [ENSMUST00000217588]
Predicted Effect probably damaging
Transcript: ENSMUST00000099811
AA Change: H63Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097399
Gene: ENSMUSG00000075115
AA Change: H63Y

DomainStartEndE-ValueType
Pfam:7tm_4 29 302 3.2e-47 PFAM
Pfam:7tm_1 39 285 2.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217588
AA Change: H63Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 94% (31/33)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 107,023,718 V340A possibly damaging Het
Btbd17 T C 11: 114,791,476 Y470C probably damaging Het
Clca1 G C 3: 145,013,883 A442G probably damaging Het
Cyp4v3 A T 8: 45,306,981 N511K probably benign Het
Efcab5 G T 11: 77,113,610 Q1097K possibly damaging Het
Epha7 T C 4: 28,813,482 probably null Het
Exoc6 A G 19: 37,571,912 T126A probably benign Het
Fnip2 T C 3: 79,481,708 Q572R probably benign Het
Gm17430 C T 18: 9,726,514 V53I probably benign Het
Gpr149 T C 3: 62,530,540 D732G probably benign Het
Hdlbp A G 1: 93,412,361 probably null Het
Herc2 A G 7: 56,207,690 probably null Het
Htt C T 5: 34,877,044 T1953I possibly damaging Het
Lgmn C T 12: 102,404,270 V134I probably damaging Het
Lysmd1 A G 3: 95,137,886 S148G probably benign Het
Man2a2 T C 7: 80,353,199 D1054G probably damaging Het
Mcph1 A G 8: 18,668,967 T640A probably damaging Het
Nat10 T C 2: 103,754,150 E94G probably null Het
Olfr110 T A 17: 37,499,097 W149R probably damaging Het
Pgm3 A G 9: 86,559,443 V367A possibly damaging Het
Ppp1r1a A C 15: 103,531,372 D164E probably damaging Het
Proca1 G T 11: 78,204,953 S137I probably benign Het
Serinc5 T C 13: 92,708,126 F459L possibly damaging Het
Slc12a8 T C 16: 33,617,256 probably null Het
Slc51a T C 16: 32,475,803 D321G probably damaging Het
Tchhl1 T A 3: 93,470,809 D273E probably damaging Het
Tlk1 G A 2: 70,714,153 R713C probably damaging Het
Tmem211 A G 5: 113,234,463 Y34C probably damaging Het
Tpr T C 1: 150,411,905 I465T possibly damaging Het
Usp1 A G 4: 98,926,519 I5M possibly damaging Het
Zcchc14 T C 8: 121,604,639 probably benign Het
Other mutations in Olfr1200
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Olfr1200 APN 2 88767466 missense probably benign 0.01
PIT4520001:Olfr1200 UTSW 2 88767577 missense possibly damaging 0.95
R0375:Olfr1200 UTSW 2 88767641 missense possibly damaging 0.77
R0525:Olfr1200 UTSW 2 88767314 nonsense probably null
R1467:Olfr1200 UTSW 2 88767488 missense probably benign 0.02
R1467:Olfr1200 UTSW 2 88767488 missense probably benign 0.02
R1613:Olfr1200 UTSW 2 88767805 missense probably damaging 1.00
R2224:Olfr1200 UTSW 2 88767586 missense possibly damaging 0.89
R2760:Olfr1200 UTSW 2 88767636 missense possibly damaging 0.61
R3434:Olfr1200 UTSW 2 88768069 missense probably damaging 1.00
R6156:Olfr1200 UTSW 2 88767590 missense probably benign 0.01
R6251:Olfr1200 UTSW 2 88768288 missense probably damaging 1.00
R6582:Olfr1200 UTSW 2 88768243 missense probably damaging 0.96
R6600:Olfr1200 UTSW 2 88767757 missense probably benign 0.02
R6774:Olfr1200 UTSW 2 88767884 missense probably benign 0.00
R7140:Olfr1200 UTSW 2 88767964 missense probably damaging 1.00
X0026:Olfr1200 UTSW 2 88767433 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGGGCTTGACAATGGCAAC -3'
(R):5'- GGCTGTGCATGTGGATTCAAC -3'

Sequencing Primer
(F):5'- ACATAGCGGTCCAAGGCCATG -3'
(R):5'- GTGCATGTGGATTCAACTAGAATTC -3'
Posted On2018-06-22