Incidental Mutation 'R6624:Eif3l'
ID524690
Institutional Source Beutler Lab
Gene Symbol Eif3l
Ensembl Gene ENSMUSG00000033047
Gene Nameeukaryotic translation initiation factor 3, subunit L
SynonymsD15N1e, Eif3s6ip, Eif3eip, PAF67, 0610011H21Rik, HSP-66Y
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R6624 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location79075179-79094405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79089929 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 515 (S515P)
Ref Sequence ENSEMBL: ENSMUSP00000038839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040518]
Predicted Effect probably damaging
Transcript: ENSMUST00000040518
AA Change: S515P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038839
Gene: ENSMUSG00000033047
AA Change: S515P

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
Pfam:Paf67 152 550 7e-179 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230032
Meta Mutation Damage Score 0.184 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,904,468 E852K possibly damaging Het
Cib3 T A 8: 72,205,738 I96F probably damaging Het
Ckap5 C T 2: 91,577,651 P841S probably benign Het
Col25a1 A G 3: 130,566,451 probably null Het
Col27a1 A T 4: 63,225,011 H312L probably benign Het
Cyp2j7 A G 4: 96,227,618 I197T probably damaging Het
Cyp4f40 C T 17: 32,671,180 R275C possibly damaging Het
Enpp1 A T 10: 24,669,755 Y262* probably null Het
Ergic3 T A 2: 156,016,898 M286K probably damaging Het
Ern2 C T 7: 122,177,783 A305T probably benign Het
Fam187b A G 7: 30,977,187 I40M probably benign Het
Fcho1 T G 8: 71,709,371 K798T probably damaging Het
Iah1 C T 12: 21,319,784 Q100* probably null Het
Jak2 T C 19: 29,282,589 I296T probably damaging Het
Lats2 A G 14: 57,694,312 probably null Het
Lrriq4 A T 3: 30,650,780 H319L probably benign Het
Man2b1 A G 8: 85,096,853 N939D probably benign Het
Meis1 T C 11: 19,016,215 T53A probably benign Het
Nadsyn1 C T 7: 143,805,973 E421K probably benign Het
Olfr512 T C 7: 108,713,536 I49T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pmfbp1 T C 8: 109,530,190 S509P possibly damaging Het
Pou4f3 A T 18: 42,395,642 I217F probably damaging Het
Ppara C A 15: 85,791,036 N235K probably benign Het
Prrg2 T C 7: 45,059,986 Y73C probably damaging Het
Sdccag8 T A 1: 176,874,812 probably null Het
Thap12 T G 7: 98,715,586 Y320* probably null Het
Trpm6 T A 19: 18,889,020 C1978S probably damaging Het
Trpm6 A G 19: 18,796,439 probably null Het
Usp33 A G 3: 152,381,798 Y708C probably damaging Het
Wdr3 G A 3: 100,144,326 T669M probably damaging Het
Zdbf2 T C 1: 63,303,914 I484T possibly damaging Het
Other mutations in Eif3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Eif3l APN 15 79076920 missense possibly damaging 0.82
IGL02457:Eif3l APN 15 79078096 missense probably benign 0.01
IGL02658:Eif3l APN 15 79076942 missense probably damaging 1.00
IGL02689:Eif3l APN 15 79086519 missense possibly damaging 0.77
IGL02797:Eif3l APN 15 79075277 missense probably benign 0.00
IGL02824:Eif3l APN 15 79075823 splice site probably null
IGL02957:Eif3l APN 15 79089828 missense probably benign 0.00
IGL03352:Eif3l APN 15 79077051 unclassified probably benign
R0528:Eif3l UTSW 15 79089609 missense probably benign 0.00
R0550:Eif3l UTSW 15 79076867 missense probably damaging 1.00
R0751:Eif3l UTSW 15 79075766 splice site probably null
R1101:Eif3l UTSW 15 79075267 missense probably damaging 1.00
R1184:Eif3l UTSW 15 79075766 splice site probably null
R1585:Eif3l UTSW 15 79084181 missense possibly damaging 0.63
R1895:Eif3l UTSW 15 79089477 missense possibly damaging 0.55
R2442:Eif3l UTSW 15 79085607 missense probably damaging 1.00
R4865:Eif3l UTSW 15 79081649 nonsense probably null
R5092:Eif3l UTSW 15 79084154 missense probably benign 0.01
R5239:Eif3l UTSW 15 79089795 missense possibly damaging 0.95
R5328:Eif3l UTSW 15 79093361 nonsense probably null
R6575:Eif3l UTSW 15 79086578 missense possibly damaging 0.67
R6875:Eif3l UTSW 15 79085560 missense probably damaging 0.99
R7484:Eif3l UTSW 15 79084136 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCAGCTGAAGGTGTTTTCC -3'
(R):5'- TCCCACTTCTGCATGCACAG -3'

Sequencing Primer
(F):5'- TTCCGATGAGGTGCAGCAG -3'
(R):5'- GCACAGCATTTTATCCCCCAC -3'
Posted On2018-06-22