Incidental Mutation 'R6624:Cyp4f40'
ID524694
Institutional Source Beutler Lab
Gene Symbol Cyp4f40
Ensembl Gene ENSMUSG00000090700
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 40
SynonymsEG631304
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6624 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location32659410-32676687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32671180 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 275 (R275C)
Ref Sequence ENSEMBL: ENSMUSP00000129536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165061]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165061
AA Change: R275C

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129536
Gene: ENSMUSG00000090700
AA Change: R275C

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 52 515 2.2e-130 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP4F11, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Another member of this family, CYP4F2, is approximately 16 kb away. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,904,468 E852K possibly damaging Het
Cib3 T A 8: 72,205,738 I96F probably damaging Het
Ckap5 C T 2: 91,577,651 P841S probably benign Het
Col25a1 A G 3: 130,566,451 probably null Het
Col27a1 A T 4: 63,225,011 H312L probably benign Het
Cyp2j7 A G 4: 96,227,618 I197T probably damaging Het
Eif3l T C 15: 79,089,929 S515P probably damaging Het
Enpp1 A T 10: 24,669,755 Y262* probably null Het
Ergic3 T A 2: 156,016,898 M286K probably damaging Het
Ern2 C T 7: 122,177,783 A305T probably benign Het
Fam187b A G 7: 30,977,187 I40M probably benign Het
Fcho1 T G 8: 71,709,371 K798T probably damaging Het
Iah1 C T 12: 21,319,784 Q100* probably null Het
Jak2 T C 19: 29,282,589 I296T probably damaging Het
Lats2 A G 14: 57,694,312 probably null Het
Lrriq4 A T 3: 30,650,780 H319L probably benign Het
Man2b1 A G 8: 85,096,853 N939D probably benign Het
Meis1 T C 11: 19,016,215 T53A probably benign Het
Nadsyn1 C T 7: 143,805,973 E421K probably benign Het
Olfr512 T C 7: 108,713,536 I49T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pmfbp1 T C 8: 109,530,190 S509P possibly damaging Het
Pou4f3 A T 18: 42,395,642 I217F probably damaging Het
Ppara C A 15: 85,791,036 N235K probably benign Het
Prrg2 T C 7: 45,059,986 Y73C probably damaging Het
Sdccag8 T A 1: 176,874,812 probably null Het
Thap12 T G 7: 98,715,586 Y320* probably null Het
Trpm6 A G 19: 18,796,439 probably null Het
Trpm6 T A 19: 18,889,020 C1978S probably damaging Het
Usp33 A G 3: 152,381,798 Y708C probably damaging Het
Wdr3 G A 3: 100,144,326 T669M probably damaging Het
Zdbf2 T C 1: 63,303,914 I484T possibly damaging Het
Other mutations in Cyp4f40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Cyp4f40 APN 17 32667974 missense probably benign 0.00
IGL01563:Cyp4f40 APN 17 32673956 missense probably damaging 0.99
IGL01801:Cyp4f40 APN 17 32676305 missense probably damaging 1.00
IGL01960:Cyp4f40 APN 17 32659561 missense probably benign 0.25
IGL02387:Cyp4f40 APN 17 32668010 missense probably damaging 1.00
IGL02631:Cyp4f40 APN 17 32675635 splice site probably benign
IGL02967:Cyp4f40 APN 17 32674248 missense probably damaging 1.00
R0030:Cyp4f40 UTSW 17 32675973 missense probably damaging 1.00
R0103:Cyp4f40 UTSW 17 32676308 missense probably damaging 1.00
R0103:Cyp4f40 UTSW 17 32676309 nonsense probably null
R0180:Cyp4f40 UTSW 17 32659667 missense probably benign 0.00
R1413:Cyp4f40 UTSW 17 32673939 missense probably benign 0.35
R2882:Cyp4f40 UTSW 17 32668073 missense probably benign 0.05
R3903:Cyp4f40 UTSW 17 32659624 missense possibly damaging 0.51
R4378:Cyp4f40 UTSW 17 32668029 missense probably null 0.44
R4465:Cyp4f40 UTSW 17 32671212 missense probably benign 0.00
R4808:Cyp4f40 UTSW 17 32674275 missense probably benign 0.23
R5377:Cyp4f40 UTSW 17 32675616 missense probably null 0.61
R5395:Cyp4f40 UTSW 17 32669853 missense probably benign 0.01
R5523:Cyp4f40 UTSW 17 32669822 missense probably damaging 0.98
R5889:Cyp4f40 UTSW 17 32675757 missense probably benign 0.15
R6692:Cyp4f40 UTSW 17 32675742 missense possibly damaging 0.48
R6859:Cyp4f40 UTSW 17 32675949 missense probably benign 0.19
Z1088:Cyp4f40 UTSW 17 32674002 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAGCCTAGCCAGTATATTGCTG -3'
(R):5'- CTGAAGATGAGCCTGGCAAC -3'

Sequencing Primer
(F):5'- GCCATCTTGGAGCTCAGTAC -3'
(R):5'- CCTGGTCTACAGTGAGACTCTG -3'
Posted On2018-06-22