Incidental Mutation 'R6625:Vmn2r59'
ID524726
Institutional Source Beutler Lab
Gene Symbol Vmn2r59
Ensembl Gene ENSMUSG00000092032
Gene Namevomeronasal 2, receptor 59
SynonymsEG628444
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6625 (G1)
Quality Score157.009
Status Validated
Chromosome7
Chromosomal Location42011792-42058981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42043753 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 474 (F474L)
Ref Sequence ENSEMBL: ENSMUSP00000131856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168489]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121359
Predicted Effect probably benign
Transcript: ENSMUST00000168489
AA Change: F474L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000131856
Gene: ENSMUSG00000092032
AA Change: F474L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:ANF_receptor 77 471 1.8e-44 PFAM
Pfam:NCD3G 514 567 4.3e-23 PFAM
Pfam:7tm_3 600 835 5.4e-53 PFAM
Meta Mutation Damage Score 0.0504 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 91% (30/33)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Apcdd1 C A 18: 62,951,858 D375E probably damaging Het
Cacna2d1 A T 5: 16,362,393 R984W probably null Het
Csmd3 T G 15: 47,607,075 I3402L probably benign Het
Dnah7a T A 1: 53,565,757 T1281S probably benign Het
Dnmt3b T C 2: 153,665,313 I139T probably benign Het
Dtnbp1 T C 13: 44,992,031 E40G possibly damaging Het
Fam162b C T 10: 51,590,295 G43R probably damaging Het
G2e3 T G 12: 51,353,789 probably null Het
Gm13119 T A 4: 144,363,799 Y470N probably damaging Het
Gm3286 C T 5: 95,521,483 H124Y possibly damaging Het
Kiss1r G A 10: 79,919,534 V118I possibly damaging Het
Mre11a T C 9: 14,805,391 M294T possibly damaging Het
Muc16 A T 9: 18,660,278 V315D unknown Het
Nelfe C T 17: 34,854,358 P290S probably benign Het
Olfr1396 T A 11: 49,113,069 Y219F probably damaging Het
Olfr1441 T G 19: 12,422,841 H177Q probably damaging Het
Pcolce2 T A 9: 95,678,439 C180* probably null Het
Piezo2 A T 18: 63,021,262 V2482D probably damaging Het
Plagl1 T C 10: 13,128,062 probably benign Het
Ppp1r32 G A 19: 10,481,736 P65L probably damaging Het
Prss48 G T 3: 85,998,066 Q167K probably benign Het
Scyl1 C A 19: 5,760,826 V488F probably damaging Het
Sh3pxd2b T A 11: 32,422,594 L587Q possibly damaging Het
Sim1 A G 10: 50,983,986 D648G probably benign Het
Snupn G A 9: 56,982,770 V292I probably benign Het
St6galnac1 T C 11: 116,765,891 H474R probably damaging Het
Thap12 G A 7: 98,716,070 V482I probably benign Het
Usp13 T A 3: 32,894,876 V454D probably damaging Het
Usp40 T C 1: 87,967,213 I862V probably benign Het
Zbtb38 T C 9: 96,687,313 R573G probably damaging Het
Zfp493 C T 13: 67,786,395 Q156* probably null Het
Zfp873 C A 10: 82,060,304 P290T probably damaging Het
Other mutations in Vmn2r59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Vmn2r59 APN 7 42012064 missense possibly damaging 0.91
IGL01432:Vmn2r59 APN 7 42012559 missense possibly damaging 0.82
IGL02119:Vmn2r59 APN 7 42046169 missense probably benign 0.36
IGL02216:Vmn2r59 APN 7 42012393 missense probably damaging 1.00
IGL02327:Vmn2r59 APN 7 42012231 missense probably benign
IGL03346:Vmn2r59 APN 7 42043829 missense probably benign 0.00
IGL03411:Vmn2r59 APN 7 42058916 missense probably benign 0.43
IGL03412:Vmn2r59 APN 7 42012438 missense probably benign
PIT4366001:Vmn2r59 UTSW 7 42045781 missense possibly damaging 0.91
R0068:Vmn2r59 UTSW 7 42046301 missense probably damaging 0.99
R0094:Vmn2r59 UTSW 7 42012298 missense probably benign 0.07
R0179:Vmn2r59 UTSW 7 42047008 nonsense probably null
R0370:Vmn2r59 UTSW 7 42012726 missense probably benign 0.23
R0412:Vmn2r59 UTSW 7 42046492 splice site probably benign
R0465:Vmn2r59 UTSW 7 42046908 missense probably benign
R0487:Vmn2r59 UTSW 7 42047104 nonsense probably null
R0576:Vmn2r59 UTSW 7 42047105 missense probably benign 0.01
R0632:Vmn2r59 UTSW 7 42058884 missense probably damaging 1.00
R1356:Vmn2r59 UTSW 7 42011794 makesense probably null
R1387:Vmn2r59 UTSW 7 42046097 missense probably damaging 1.00
R1388:Vmn2r59 UTSW 7 42045709 missense probably benign 0.01
R1435:Vmn2r59 UTSW 7 42046205 missense possibly damaging 0.50
R1750:Vmn2r59 UTSW 7 42045827 missense possibly damaging 0.50
R2020:Vmn2r59 UTSW 7 42043779 missense probably damaging 1.00
R2249:Vmn2r59 UTSW 7 42058902 missense probably benign 0.00
R2256:Vmn2r59 UTSW 7 42012245 nonsense probably null
R2257:Vmn2r59 UTSW 7 42012245 nonsense probably null
R2441:Vmn2r59 UTSW 7 42046146 missense probably benign 0.00
R2511:Vmn2r59 UTSW 7 42043766 missense probably damaging 1.00
R2860:Vmn2r59 UTSW 7 42047003 missense possibly damaging 0.79
R2861:Vmn2r59 UTSW 7 42047003 missense possibly damaging 0.79
R3690:Vmn2r59 UTSW 7 42011946 missense possibly damaging 0.77
R3912:Vmn2r59 UTSW 7 42046320 missense probably benign 0.00
R4167:Vmn2r59 UTSW 7 42021308 intron probably benign
R4357:Vmn2r59 UTSW 7 42012220 missense probably damaging 1.00
R4445:Vmn2r59 UTSW 7 42042450 missense probably damaging 1.00
R4542:Vmn2r59 UTSW 7 42046073 missense possibly damaging 0.93
R4587:Vmn2r59 UTSW 7 42046224 missense probably benign 0.00
R4616:Vmn2r59 UTSW 7 42012438 missense probably benign
R4653:Vmn2r59 UTSW 7 42043804 missense probably benign 0.19
R4703:Vmn2r59 UTSW 7 42012262 missense probably benign 0.01
R4895:Vmn2r59 UTSW 7 42045794 missense probably damaging 0.98
R4910:Vmn2r59 UTSW 7 42043653 missense probably benign
R5045:Vmn2r59 UTSW 7 42046072 missense possibly damaging 0.93
R5105:Vmn2r59 UTSW 7 42047105 missense probably benign 0.01
R5153:Vmn2r59 UTSW 7 42042410 critical splice donor site probably null
R5566:Vmn2r59 UTSW 7 42046823 missense possibly damaging 0.92
R5586:Vmn2r59 UTSW 7 42045681 missense probably benign 0.12
R5606:Vmn2r59 UTSW 7 42045894 missense probably benign 0.27
R5616:Vmn2r59 UTSW 7 42058767 splice site probably null
R5625:Vmn2r59 UTSW 7 42046460 missense probably benign 0.03
R5696:Vmn2r59 UTSW 7 42046044 missense probably benign 0.00
R5982:Vmn2r59 UTSW 7 42046067 missense probably benign 0.00
R6106:Vmn2r59 UTSW 7 42012325 nonsense probably null
R6196:Vmn2r59 UTSW 7 42012255 missense probably benign 0.36
R6228:Vmn2r59 UTSW 7 42042411 critical splice donor site probably null
R6590:Vmn2r59 UTSW 7 42046466 missense probably damaging 1.00
R6690:Vmn2r59 UTSW 7 42046466 missense probably damaging 1.00
R6768:Vmn2r59 UTSW 7 42011968 missense probably benign 0.17
R6830:Vmn2r59 UTSW 7 42043747 missense probably benign 0.10
R6859:Vmn2r59 UTSW 7 42043853 missense probably damaging 1.00
R7034:Vmn2r59 UTSW 7 42046220 missense probably benign 0.03
R7036:Vmn2r59 UTSW 7 42046220 missense probably benign 0.03
R7145:Vmn2r59 UTSW 7 42045764 missense probably damaging 1.00
X0025:Vmn2r59 UTSW 7 42045941 missense probably damaging 1.00
Z1088:Vmn2r59 UTSW 7 42012414 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TGAGAGTTCATTGATCATGACATCC -3'
(R):5'- AACAGCTGTCCTGGCTTCATG -3'

Sequencing Primer
(F):5'- GTAGGCCACTGTATCATCT -3'
(R):5'- TGGAAATGGCTGTTTCAAATGAG -3'
Posted On2018-06-22