Incidental Mutation 'R6625:Ppp1r32'
ID524772
Institutional Source Beutler Lab
Gene Symbol Ppp1r32
Ensembl Gene ENSMUSG00000035179
Gene Nameprotein phosphatase 1, regulatory subunit 32
SynonymsIIIG9L, 4930579J09Rik, IIIG9S, IIIG9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6625 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location10474257-10482897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 10481736 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 65 (P65L)
Ref Sequence ENSEMBL: ENSMUSP00000035684 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000038842
AA Change: P65L

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.0248 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 91% (30/33)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Apcdd1 C A 18: 62,951,858 D375E probably damaging Het
Cacna2d1 A T 5: 16,362,393 R984W probably null Het
Csmd3 T G 15: 47,607,075 I3402L probably benign Het
Dnah7a T A 1: 53,565,757 T1281S probably benign Het
Dnmt3b T C 2: 153,665,313 I139T probably benign Het
Dtnbp1 T C 13: 44,992,031 E40G possibly damaging Het
Fam162b C T 10: 51,590,295 G43R probably damaging Het
G2e3 T G 12: 51,353,789 probably null Het
Gm13119 T A 4: 144,363,799 Y470N probably damaging Het
Gm3286 C T 5: 95,521,483 H124Y possibly damaging Het
Kiss1r G A 10: 79,919,534 V118I possibly damaging Het
Mre11a T C 9: 14,805,391 M294T possibly damaging Het
Muc16 A T 9: 18,660,278 V315D unknown Het
Nelfe C T 17: 34,854,358 P290S probably benign Het
Olfr1396 T A 11: 49,113,069 Y219F probably damaging Het
Olfr1441 T G 19: 12,422,841 H177Q probably damaging Het
Pcolce2 T A 9: 95,678,439 C180* probably null Het
Piezo2 A T 18: 63,021,262 V2482D probably damaging Het
Plagl1 T C 10: 13,128,062 probably benign Het
Prss48 G T 3: 85,998,066 Q167K probably benign Het
Scyl1 C A 19: 5,760,826 V488F probably damaging Het
Sh3pxd2b T A 11: 32,422,594 L587Q possibly damaging Het
Sim1 A G 10: 50,983,986 D648G probably benign Het
Snupn G A 9: 56,982,770 V292I probably benign Het
St6galnac1 T C 11: 116,765,891 H474R probably damaging Het
Thap12 G A 7: 98,716,070 V482I probably benign Het
Usp13 T A 3: 32,894,876 V454D probably damaging Het
Usp40 T C 1: 87,967,213 I862V probably benign Het
Vmn2r59 A T 7: 42,043,753 F474L probably benign Het
Zbtb38 T C 9: 96,687,313 R573G probably damaging Het
Zfp493 C T 13: 67,786,395 Q156* probably null Het
Zfp873 C A 10: 82,060,304 P290T probably damaging Het
Other mutations in Ppp1r32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Ppp1r32 APN 19 10477523 critical splice donor site probably null
IGL00979:Ppp1r32 APN 19 10474499 makesense probably null
IGL02405:Ppp1r32 APN 19 10474566 missense probably damaging 1.00
IGL02664:Ppp1r32 APN 19 10482291 missense probably damaging 1.00
IGL03105:Ppp1r32 APN 19 10477020 splice site probably benign
R0255:Ppp1r32 UTSW 19 10475054 missense probably damaging 1.00
R0268:Ppp1r32 UTSW 19 10477085 missense possibly damaging 0.88
R1018:Ppp1r32 UTSW 19 10479460 splice site probably benign
R1559:Ppp1r32 UTSW 19 10481406 missense probably benign 0.01
R2384:Ppp1r32 UTSW 19 10481282 critical splice donor site probably null
R4362:Ppp1r32 UTSW 19 10475021 missense probably damaging 1.00
R4884:Ppp1r32 UTSW 19 10474501 makesense probably null
R5998:Ppp1r32 UTSW 19 10481352 missense possibly damaging 0.50
R6130:Ppp1r32 UTSW 19 10477764 missense probably benign 0.16
R6360:Ppp1r32 UTSW 19 10479481 missense probably damaging 1.00
R6388:Ppp1r32 UTSW 19 10482301 missense probably damaging 1.00
R6754:Ppp1r32 UTSW 19 10477089 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTATTCCCAGGAGCATCATCTC -3'
(R):5'- TTAGGGTTCCTTAGGCCCTG -3'

Sequencing Primer
(F):5'- AATGTTTTAAGAGTCCTTCTTGGCC -3'
(R):5'- CTGGTGGCTGCTGGCTC -3'
Posted On2018-06-22